ID: 919492261

View in Genome Browser
Species Human (GRCh38)
Location 1:198219540-198219562
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1002
Summary {0: 5, 1: 33, 2: 108, 3: 253, 4: 603}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900226018 1:1534058-1534080 CTGTGGACTCAGGATGGGGAGGG - Exonic
900846282 1:5104567-5104589 GTTGAGATTCACAATGGGGATGG + Intergenic
901262848 1:7886152-7886174 GGGGAGACTCAGAGTGGGCAGGG - Intergenic
901748283 1:11389129-11389151 CTGCAGACTCAGAGGGGGGAAGG - Intergenic
902216410 1:14937023-14937045 TTGGGGGCCCAGGATGGGGAGGG - Intronic
902553940 1:17235682-17235704 ATGCAGACTCAGGAAGGGGAGGG + Intronic
902729071 1:18356923-18356945 ATGGAGATTGAGGATGGGGAGGG + Intronic
903751949 1:25628749-25628771 TTGGAGACTCAGAAGGGGGAGGG - Intronic
903950063 1:26991515-26991537 GTGGAGACTCAGTGAGGGGAAGG - Intergenic
904990990 1:34592448-34592470 ATGGATACTCAGAGTGGTGAGGG - Intergenic
906736161 1:48130938-48130960 ATGGAGACTCAGAAGGGTGAGGG - Intergenic
906882199 1:49603719-49603741 CTGGAGACTCAGAATGGGGGAGG - Intronic
906953205 1:50350783-50350805 ATGGGGAGTCAGAAGGGGGATGG - Intergenic
906994254 1:50773315-50773337 CTGCAGACTCAGAAGTGGGATGG - Intronic
907265643 1:53258776-53258798 TTAGAGACTAAAAATGGAGAAGG - Intronic
907409453 1:54274154-54274176 GGCGAGACCCAGAATGGGGAGGG + Intronic
907415570 1:54311717-54311739 TTGGAGACTCTGACTCGGCACGG - Intronic
907913746 1:58849852-58849874 TTCGAGACTGGGAGTGGGGAAGG - Intergenic
908595038 1:65678937-65678959 TTGGAGACTCAGAATAGGAGAGG - Intergenic
908771778 1:67603921-67603943 TTGGAGACTCAGAAATGGGGAGG + Intergenic
908959377 1:69676936-69676958 CTGGAGACTCAGAAGGGAAAGGG - Intronic
909206091 1:72759530-72759552 TTAAAGACTCAGGATAGGGAGGG - Intergenic
910086935 1:83414212-83414234 TTAAAGACTCAGAAAGGGGTGGG + Intergenic
910511023 1:88004493-88004515 TTGATGACTAAGAATGTGGAAGG - Intergenic
911457797 1:98148905-98148927 TTAGAGACTCAGAAGGGGAAAGG + Intergenic
911795329 1:102068738-102068760 TTAGAGATTCAGAAGGGGGAGGG + Intergenic
911946207 1:104112760-104112782 TTGGAGACTCAAAAGGGGGAAGG - Intergenic
911956667 1:104244187-104244209 TCAGAGACTAAGAAGGGGGAGGG + Intergenic
912003539 1:104864322-104864344 TTGGAGACTCTGAAGGGGGAAGG - Intergenic
912079227 1:105914020-105914042 TTATAGGCACAGAATGGGGATGG - Intergenic
912424306 1:109573024-109573046 GTTGAGAGTCAGAATTGGGAGGG + Intronic
912849632 1:113111479-113111501 TTAGAGATTCAGAATGGAGAGGG - Intronic
913572424 1:120134038-120134060 TTTGAGATTCAGACAGGGGAAGG - Intergenic
913576250 1:120178075-120178097 TTAGAGACTTAGAAGGCGGAGGG - Intergenic
915076281 1:153310618-153310640 CTGGAGACCCAGAATGAAGAAGG + Exonic
915293433 1:154902068-154902090 TGGGGGAGTCAGTATGGGGATGG + Intergenic
915478856 1:156171373-156171395 AAGGAGGCTCAGAATGGAGAAGG + Intronic
915565123 1:156708661-156708683 CTGGAGACTCAGTGAGGGGAGGG + Intergenic
915694891 1:157729888-157729910 TTGGAGACTCAGAAGAAGGAGGG + Intergenic
915983804 1:160442925-160442947 TTGGAGACTCAGAAGCAGGAAGG - Intergenic
916299744 1:163260491-163260513 TTACAGACTCAGCAGGGGGAGGG + Intronic
916453244 1:164941860-164941882 TTGGAGACTCTGAAGGGAGGAGG - Intergenic
916598874 1:166273102-166273124 ATGGTGACTCAGAGTGGGGAAGG + Intergenic
916636847 1:166680054-166680076 ATGGAGACTGAGAAGGAGGAGGG - Intergenic
916733063 1:167583461-167583483 TTATGGACTCAGAATGGGGAGGG - Intergenic
916902779 1:169247640-169247662 TTGGCGACTCAGAAGAGGGAGGG - Intronic
917410822 1:174758452-174758474 TTGGAGACTCAGAAGGGGAAAGG - Intronic
917505317 1:175622192-175622214 TTGGAGACTCTGAATCTGGAAGG + Intronic
917917569 1:179718878-179718900 CTGGAGACTCCAAAAGGGGAGGG - Intergenic
918002435 1:180510087-180510109 TTAGAGACTCAGCAGGGGGAGGG - Intergenic
918246337 1:182662936-182662958 CTGTAGATTGAGAATGGGGAGGG + Intronic
918566880 1:185944302-185944324 TTGAAGACTCAGAAGGGAGAGGG + Intronic
918570483 1:185985779-185985801 ATGGAGACACAGAATGATGAAGG - Intronic
918725611 1:187918097-187918119 TTGGAGACTCAGAATGGGGAGGG + Intergenic
918928876 1:190826700-190826722 ATGGAGATTCAGAAGGGTGAGGG + Intergenic
919211611 1:194494144-194494166 TTGGAGACTCAGAAGGGGGAGGG + Intergenic
919492261 1:198219540-198219562 TTGGAGACTCAGAATGGGGAAGG + Intronic
919613993 1:199782164-199782186 TTGGAGACTGAGAAGAGGGGGGG + Intergenic
920019675 1:202945849-202945871 ATGGAGACTTAGAAGCGGGAGGG + Intronic
920611143 1:207438966-207438988 TTGGAGACTCAGAAGGGGGAAGG + Intergenic
921562753 1:216677945-216677967 TTGCAGCATCAGAATGAGGAAGG - Intronic
921773752 1:219073096-219073118 TTGGAGACTTGGAAGGTGGAAGG - Intergenic
922022160 1:221716307-221716329 TTTGTGAGACAGAATGGGGAGGG - Intronic
922122927 1:222691699-222691721 TTAGATACTAAGAATGGGAAAGG + Intronic
922279001 1:224104828-224104850 TTGGAGACTCAGAAGCAGGGAGG + Intergenic
922323812 1:224510398-224510420 TGGGAGACTCAGAATTGAGGTGG + Intronic
922623959 1:227018292-227018314 TTGGAGACTCAGGGTGGCAATGG + Intronic
922647199 1:227300658-227300680 GTGGAGACTCAGAAGGGAGAAGG + Intronic
922860832 1:228814946-228814968 TTAGAGACTCAGAAAGGGGAGGG - Intergenic
922995053 1:229950307-229950329 GTAGAGACTCAGAAGCGGGAGGG - Intergenic
923249345 1:232165764-232165786 TTGGAGACTCAGAGTGGGGAGGG + Intergenic
923482286 1:234396881-234396903 TGGGGGACTCAGAATGAGAAGGG + Intronic
923744832 1:236690837-236690859 CTGGAGACACAGAGTGGTGATGG - Intronic
923751194 1:236747496-236747518 GTGGAGGCTCAGAAGGGTGAGGG - Intronic
923880903 1:238103176-238103198 TTAGAGACTCAGCAGGGGGAAGG - Intergenic
923944843 1:238873026-238873048 TTGGAGACTCGGTAGGGAGAGGG - Intergenic
924108113 1:240669712-240669734 ATGGAGACTCAGAAGGGTGAAGG - Intergenic
924506049 1:244684992-244685014 TTGGAGAGCCAGAATTTGGATGG - Intronic
924621992 1:245669971-245669993 TTGGAGACTCCGAAGGGGAAAGG + Intronic
1063281520 10:4634289-4634311 TTGGAGACTGAGAAGGAGGGAGG + Intergenic
1063414813 10:5864691-5864713 CTGGAGATCCATAATGGGGACGG - Intronic
1064020086 10:11801977-11801999 CTGGAGACTCAGAAGGAGGGAGG + Intergenic
1064594216 10:16926984-16927006 TTGGAGACTCAGAAGTGGGGAGG - Intronic
1064832409 10:19485162-19485184 TTGGAAACTCAGAAAGAGGGAGG + Intronic
1064955500 10:20903856-20903878 ATGGAGACTCAGAAGGGAGAAGG + Intronic
1065187739 10:23185411-23185433 TTGCAGACTCAGAAGTGGGGTGG + Intergenic
1065319690 10:24497813-24497835 TTGGAGACTCAGAAGTGGGCAGG + Intronic
1065423677 10:25576202-25576224 CTGGAGACTCAGAAGGGGTTAGG - Intronic
1065588400 10:27241565-27241587 TAGGAGACTGGGCATGGGGACGG + Intronic
1066374578 10:34846088-34846110 TTGTAGTCTCAGGATGGGGGTGG - Intergenic
1066585862 10:36934645-36934667 TTGGAGACACAGGATTGTGAAGG - Intergenic
1066597788 10:37071062-37071084 TTGGAGACTCAGAAGTGGGGAGG - Intergenic
1066994790 10:42553583-42553605 TTAGAGACTCAGAAGGGGGCTGG + Intergenic
1067550337 10:47229835-47229857 TTGGAAACTCAGAATCAGGAAGG - Intergenic
1067784394 10:49233229-49233251 TGGGAGACTCAGAATGGGGGAGG + Intergenic
1067935266 10:50605904-50605926 ATGGAGACTCAGAAGGGTGAAGG - Intronic
1068168778 10:53365891-53365913 TTTGAGAAGCAGAATGGGAATGG + Intergenic
1068553280 10:58429594-58429616 ATGGAGACTCAGAAGAGTGAAGG - Intergenic
1068640260 10:59396956-59396978 ATGGAGACTCAGAAGGGTGAGGG - Intergenic
1069024362 10:63523296-63523318 TTGGAGAATCAGAAAAGGCAAGG + Intronic
1069149792 10:64945373-64945395 TGGGACTATCAGAATGGGGATGG + Intergenic
1069238184 10:66104601-66104623 TTGGAGACTCAGAAGCAGGGAGG - Intronic
1069756340 10:70776297-70776319 TTGGACACAGAGAATGGAGAAGG - Intronic
1070103495 10:73411284-73411306 TTAGAGACTCAGAAAGGGGAGGG + Intronic
1071299595 10:84246386-84246408 CTGGAGACTCAGAAGGGGAAGGG - Intronic
1072223104 10:93344405-93344427 TTGGAGACTCAGAAGGGGGAGGG - Intronic
1072324894 10:94288232-94288254 TTGGAGACTCAGAATGAGAGTGG - Intronic
1072444979 10:95491252-95491274 TTGGGAAGTCAGAGTGGGGAAGG - Intronic
1072872126 10:99131729-99131751 TTGGAGACTCAGAGTTGGAGAGG + Intronic
1073193016 10:101665640-101665662 TTGGAGACTGACTTTGGGGAAGG - Intronic
1073763605 10:106657442-106657464 TTGGAGAGTCAGAAAGGGTGAGG + Intronic
1073790465 10:106934899-106934921 CTGGAAACTCAGAAAAGGGAGGG + Intronic
1074734847 10:116419596-116419618 TTGGAGACTCAGAAGTGGGAGGG - Intergenic
1074887413 10:117705089-117705111 GAGGAAACTCAGCATGGGGAAGG - Intergenic
1075303631 10:121348236-121348258 TTTCAGACTCTGGATGGGGAAGG - Intergenic
1075696211 10:124437498-124437520 TTGGAGTCTCAGGATCGGGGAGG - Intergenic
1075953427 10:126501898-126501920 TCAGAGACTCAGAAAGGGGAGGG + Intronic
1075987653 10:126801404-126801426 CTGGAGACTCAGAAGGGTGGGGG - Intergenic
1076022054 10:127082107-127082129 TTGGCGCCTCAGGCTGGGGAAGG + Intronic
1076258673 10:129048802-129048824 TTGGGGACACAGAACAGGGAGGG + Intergenic
1076347583 10:129790391-129790413 TTAGAGACTCAGAAGCGGGAGGG + Intergenic
1077076282 11:703629-703651 CTGGAGACGCAGGATGGGGTAGG + Intronic
1077516222 11:3003599-3003621 TCAGAGACTCAGGATGGGGCTGG + Intronic
1078243442 11:9551454-9551476 GTGGAGGCTGAGAGTGGGGATGG + Intergenic
1078673335 11:13385091-13385113 TTTGAGACTCAGCCAGGGGAAGG + Intronic
1079467799 11:20748563-20748585 TTGGAGACTGAGAAGGCAGAAGG - Intronic
1079812812 11:25016308-25016330 TTACAGACTCAGAAGGGGGAAGG - Intronic
1079879842 11:25913012-25913034 CTGGAGACTCAAAAGTGGGAAGG + Intergenic
1079919358 11:26413063-26413085 TTTGTGCCTCAGAATGGGAATGG + Intronic
1080047543 11:27825149-27825171 TTAGAGACTCAGAAAGGGCAGGG - Intergenic
1080510706 11:32967310-32967332 TTGGAGACTCAGAAGGGGAGAGG + Intronic
1080609292 11:33890128-33890150 CTGGAGACTCAGAAGGGTGGGGG + Intronic
1080675792 11:34425551-34425573 TTTGAGACTCAGAAGGGGGAGGG + Intergenic
1080683554 11:34497055-34497077 TTGAAGAATCAGAAAGAGGATGG + Intronic
1080697371 11:34614350-34614372 TTGCATACTAAGAATGAGGATGG + Intergenic
1081155908 11:39690144-39690166 TTGGAGACTCAGAAAGGGGAAGG - Intergenic
1081405808 11:42696267-42696289 CTGGAGACTCAGAAGAGGGGAGG + Intergenic
1081894162 11:46570318-46570340 GAGGAGACTTAGAGTGGGGATGG - Intronic
1082119269 11:48360618-48360640 TTGGAGACTCAGAAGCGGGAAGG + Intergenic
1082202983 11:49396303-49396325 TTTGAGACTCAGAAGGTGGGAGG - Intergenic
1082255027 11:50024529-50024551 CTGGAGACTCAGAAGCGGGAAGG - Intergenic
1082697351 11:56385730-56385752 TTAGAGACTCAGAAAAGGGGTGG + Intergenic
1083132662 11:60640300-60640322 CTGGAGACTCAGAAGCGGGAGGG + Intergenic
1083169452 11:60914359-60914381 CTGGAGAGTCCGAGTGGGGAGGG + Intronic
1083862755 11:65432846-65432868 CTAGAGACTCAAAGTGGGGAGGG - Intergenic
1084554433 11:69867530-69867552 ATGGAGCATCAGAATGGGGAAGG - Intergenic
1084661387 11:70548543-70548565 TTGGGGACTCTGGAAGGGGAAGG - Intronic
1085453776 11:76654669-76654691 GTGGTGGCTGAGAATGGGGAGGG - Intergenic
1085998342 11:81949762-81949784 TTGGGGACTCGGAAGGGGAAGGG - Intergenic
1086049252 11:82569328-82569350 ATGGAAGCTCAGAAGGGGGATGG - Intergenic
1086652048 11:89303776-89303798 TTTGAAACTCAGAAGGTGGAAGG + Intergenic
1088412213 11:109546964-109546986 GTAGAGGTTCAGAATGGGGAAGG + Intergenic
1088553021 11:111033794-111033816 TTGGAGACGCAAAATGGGGAGGG + Intergenic
1089549099 11:119256722-119256744 TTAGAGACTCAGAAGCGGGGAGG - Intronic
1090869853 11:130734491-130734513 TTGAAGAGACAGAGTGGGGAGGG + Intergenic
1091004089 11:131936478-131936500 TTGGAGACTCAGAAGGAGGGTGG + Intronic
1091448381 12:557858-557880 TTGGAGACTAGGAATCAGGAAGG - Intronic
1091747032 12:2999235-2999257 CTGGGGGCTCAGAATGGGGCTGG - Intronic
1092027761 12:5257380-5257402 TTGGAGACTCAGAAGGGGGAGGG + Intergenic
1092322983 12:7498313-7498335 TTGTATACTCAGACTGGGGGCGG - Intronic
1092330090 12:7578764-7578786 TTGGAGACACAGAACAGGGTAGG - Intergenic
1092569987 12:9710847-9710869 TGGGAGAGTCAGAAGGGAGATGG - Intergenic
1092915453 12:13185208-13185230 CTGGAGACTCAGAAGGCGGAGGG + Intergenic
1093456649 12:19371465-19371487 TTGGAGACTCAGAAGGGAGAGGG - Intronic
1093628641 12:21382316-21382338 TTAGAGATTCAGAAGCGGGAGGG + Intronic
1093656748 12:21703511-21703533 TTGGAGACTCAGAGGTGGAAGGG - Intronic
1093705501 12:22270640-22270662 ATGGAGACTCAGAAAGGTAAAGG + Intronic
1093955171 12:25208689-25208711 TTGGTTAGTCAAAATGGGGAGGG - Intronic
1093977971 12:25443907-25443929 TTGGAGACTCAGAAGGGGGAAGG - Intronic
1094143975 12:27209624-27209646 ATGGAGGCTCAGAAGGGGGAGGG + Intergenic
1094166887 12:27452350-27452372 ATGGAGACTCAGGAGGGTGAAGG - Intergenic
1094415903 12:30214547-30214569 TTGGAAACTCAGAAGGGTGGTGG - Intergenic
1094816512 12:34191756-34191778 ATGGAGACTCAGCAGGGTGAGGG + Intergenic
1095557914 12:43529640-43529662 TTGGAGACTCAGAAGCGGGAGGG + Intronic
1097257343 12:57689293-57689315 ATGGAGACTCAGAAGGATGATGG + Intergenic
1097477657 12:60078625-60078647 TTGGAGACTCAGAAGGGGATAGG - Intergenic
1097620952 12:61938893-61938915 TTGGAGACTCAGAAGGAGGAGGG + Intronic
1097694373 12:62762459-62762481 TTGGAGGCTCAGAAGAGGCATGG + Intronic
1098480314 12:70950286-70950308 TTGGAGACTCAGAAGGGATGAGG - Intergenic
1098500105 12:71182168-71182190 TTGGAGACTTAGGATGGGGGAGG + Intronic
1098992733 12:77082433-77082455 ATGGAGACTCAGAAGGGTGAGGG + Intergenic
1099164156 12:79281519-79281541 CTGGAGACTCAAAAGTGGGAAGG + Intronic
1099355119 12:81624812-81624834 TCAGAGACTCAGAAGGGGGAGGG + Intronic
1099808974 12:87556641-87556663 TTAGAGAGTCAGTATGGGGAAGG + Intergenic
1099938035 12:89151387-89151409 ATGAAGACTCAGAATGGGGAGGG + Intergenic
1100016319 12:90015136-90015158 GTGTGGACTCAGAATGGGGCAGG + Intergenic
1100292076 12:93225309-93225331 TTGGAGACTAAGAAGAGGGAAGG - Intergenic
1100762555 12:97825327-97825349 TTGGAGAATCAGAAGGGAGTGGG - Intergenic
1100779598 12:98009741-98009763 TTGAAAACTCAGAAGAGGGAGGG - Intergenic
1100893853 12:99157643-99157665 CTGGAGACTCAGAAAGGGGGAGG + Intronic
1101399926 12:104378306-104378328 TAGGGGACCCAGAAAGGGGAAGG + Intergenic
1101464474 12:104933906-104933928 CTGGAGACTCAGAAAGGGGGAGG + Intronic
1101520439 12:105477550-105477572 TTAGAGACTCAGAAAGGGGAAGG - Intergenic
1101533975 12:105600545-105600567 TTGGAGATTATGAATGGAGATGG + Intergenic
1101946738 12:109143129-109143151 TTGGAGACTCAGAGAGGGGAAGG - Intronic
1102401347 12:112632355-112632377 TTGGAGACTCAGAAAGATGGAGG - Intronic
1102724327 12:115045909-115045931 TTGGATACTAAGAATGACGATGG + Intergenic
1102897308 12:116608953-116608975 CTGGAGACTCAGAAGCGGGGCGG + Intergenic
1103105680 12:118222761-118222783 TTGGAGACTCAGAAGAGGAAGGG + Intronic
1104244449 12:127024313-127024335 TTAGAGACTCTGAAGGAGGAAGG + Intergenic
1104536616 12:129623432-129623454 TTAGAGACTCAGAAGAGGGGAGG - Intronic
1104583629 12:130029568-130029590 TTGCAGACTCAGAGTGGTGTGGG - Intergenic
1105592263 13:21803604-21803626 CTGGAGACTCAGAAGTGGGGAGG - Intergenic
1106772013 13:32970901-32970923 TTGGAGACTCAGAGCAGGGAGGG - Intergenic
1107365917 13:39675297-39675319 TTGGAGACTCACAATGTATAAGG - Intronic
1108008025 13:45972429-45972451 TTGGAGACTCAGAAGGGGGAGGG + Intronic
1108331284 13:49387191-49387213 TTAAAGACTCAGAATGGGTGTGG - Intronic
1108456815 13:50624054-50624076 CTGGAAACTCAGAAAGGAGAGGG - Intronic
1108738994 13:53315143-53315165 TTGGAGACTCAGAAGAGGGAGGG + Intergenic
1108822425 13:54369604-54369626 TTGGAGGCTCAGAAGGGAGAGGG - Intergenic
1108976642 13:56452319-56452341 TTGGAGACTCAGAATAGGGGAGG - Intergenic
1109483629 13:62990278-62990300 TTGGAAACTCAGAAGGGAGAGGG - Intergenic
1109940797 13:69361373-69361395 TTGAAGACTCAGAAGGGGGAAGG + Intergenic
1110901031 13:80824859-80824881 CTGGAGACTCAGAGTGGAGAGGG - Intergenic
1111797423 13:92940427-92940449 TTGTAATCTCAGAATAGGGAAGG - Intergenic
1112559610 13:100501371-100501393 ATGGAGACTCAGAAGGGTGACGG - Intronic
1112563694 13:100534636-100534658 TTGGGGACTCAGCATTTGGAAGG + Intronic
1112746637 13:102534247-102534269 TTGGATACTCAGAAGAGGTACGG - Intergenic
1112751574 13:102588891-102588913 TTGCAGACTCAGTCTGGTGAAGG - Intergenic
1113050290 13:106203835-106203857 TTGGAGACTCAGAGGGGGAAGGG - Intergenic
1114010926 14:18367635-18367657 CTGTAGACTCAGAAGGGTGAGGG + Intergenic
1114661987 14:24352609-24352631 TTGGAGACTCAGATGTGGGAAGG + Intergenic
1114952514 14:27773645-27773667 TTGGAGACTCAGAGCGGGGAGGG - Intergenic
1115645639 14:35367040-35367062 TGGGAGACTGGGTATGGGGAAGG - Intergenic
1115740382 14:36381550-36381572 TTGGAGACTCAGAAAGAGGGAGG + Intergenic
1115947592 14:38679674-38679696 ATGGAGACTCAGAAGGAGGAGGG - Intergenic
1116042001 14:39697407-39697429 TTGGAGACTCAGAAGGGGGGAGG - Intergenic
1116342859 14:43748281-43748303 TTGGATACTCAAAAGGGTGAGGG + Intergenic
1116683812 14:48011824-48011846 TTGTAGACTCTGAGTGGGGAAGG + Intergenic
1116754774 14:48933362-48933384 TTGGAGACTCAGAAGAGGGGAGG + Intergenic
1117517965 14:56521377-56521399 TTGGAGAGTTAGAAGGGGGAGGG - Intronic
1117640501 14:57793399-57793421 TTGGAGGCTCAGAAGGTAGAAGG - Intronic
1117740135 14:58809526-58809548 ATGGAGTCTCAGAAGGGTGAGGG - Intergenic
1117997262 14:61489542-61489564 TAGGAGACTCAGCAAGGGAAGGG + Intronic
1118433557 14:65747739-65747761 TTAGAGACTCAGAAAGAGGAGGG + Intergenic
1118918136 14:70125330-70125352 TTGGAGACTCGGAAGGGTGGGGG - Intronic
1119558513 14:75571575-75571597 TTGGAGACTCTGAGCTGGGAGGG + Intergenic
1120139588 14:80913755-80913777 GTGGAGACTCAGAAGGGAGGAGG + Intronic
1120763155 14:88304074-88304096 TGGGAGAGTGAGAAGGGGGATGG + Intronic
1120813516 14:88829090-88829112 TTCTAGACACAGAATGGTGAGGG + Intronic
1120929233 14:89831647-89831669 CTGGAGAATGAGAATGGTGAAGG + Intronic
1121295806 14:92821016-92821038 ATGGAGGCACAGAATGGTGATGG + Intronic
1122855280 14:104556998-104557020 TTAGAGACTCTTACTGGGGAGGG - Intronic
1124117713 15:26862915-26862937 CTGGAGACTTAGAAGGGAGAAGG + Intronic
1124216451 15:27811348-27811370 TTGGAGATTCAGAATGGGAAGGG + Intronic
1125552973 15:40561534-40561556 TTGGAGATTCAGAAGTGGGGAGG + Intronic
1126304046 15:47234501-47234523 TTGGAGACTCAGGAAGGGGAAGG - Intronic
1126382147 15:48059960-48059982 CTGGAGTCTCAGGACGGGGAGGG - Intergenic
1126475250 15:49058954-49058976 ATGGAGACTCAGAAGGAGGAAGG + Intergenic
1126504557 15:49389470-49389492 TTAGAGACTCAGAGCCGGGAGGG + Intronic
1126715864 15:51516795-51516817 TTAGAGACTCAGAAGAGGGAGGG - Intronic
1126753413 15:51900357-51900379 TTGGCGACTCAGGATGGGGATGG + Intronic
1126937644 15:53729026-53729048 TTGGAGAATAGGAATAGGGAAGG - Intronic
1127077320 15:55339848-55339870 CTGGTGACTCAGGGTGGGGAAGG + Intronic
1127449526 15:59103277-59103299 TTAGAGACTCAGAAGAGGGAGGG - Intergenic
1127714545 15:61636719-61636741 TTGGGGACTCAGAAGGGAGGTGG + Intergenic
1127823350 15:62680736-62680758 TTAGAGACTCAGAAGGGAAAGGG - Intronic
1128301378 15:66568140-66568162 GTGGAGGCACAGAGTGGGGAAGG + Intergenic
1129148551 15:73671786-73671808 TTGGAGCCACAGCACGGGGAGGG - Intergenic
1129232371 15:74203890-74203912 TGGCAGGCTCAGGATGGGGATGG + Intronic
1129673988 15:77622488-77622510 AGGGAGACTCAGAAAGGTGAGGG + Intronic
1129684172 15:77675883-77675905 TTGGGGAGCCAGAGTGGGGATGG - Intronic
1130043073 15:80421240-80421262 TTGGAGACTCAGAAGGGTGGAGG + Intronic
1130064476 15:80592748-80592770 GTGGGGCCTCAGAATGGGCAAGG - Intronic
1130182849 15:81648805-81648827 TTGGAGACTCAGAAGAAGGAAGG - Intergenic
1130374418 15:83315522-83315544 TTGGAGACTCAGAAGCGGGGAGG + Intergenic
1130733740 15:86526839-86526861 TTGGAGAAACAGAAGGGGGTTGG + Intronic
1131080837 15:89533476-89533498 ATGGAGACTCAGAATGCTGAGGG - Intergenic
1131329377 15:91482519-91482541 TTGGAGACTCAGAAGTGGGGAGG - Intergenic
1131572089 15:93548780-93548802 TTGGAGACTCAGAAGGGTACAGG + Intergenic
1131620077 15:94058909-94058931 TTTGAGACCCAGAGTGAGGAAGG - Intergenic
1133504395 16:6397093-6397115 TTGGAGTCCCAGAAAGAGGAAGG + Intronic
1133542090 16:6765962-6765984 TTGGAGACTCAGAAGATGGGAGG + Intronic
1133696258 16:8265838-8265860 TTGGAGACTCAGAAGGGGGAAGG - Intergenic
1133886942 16:9838894-9838916 CTGGAGACTCAGAAAGGGAGAGG + Intronic
1134128561 16:11632874-11632896 TAGGAGGCTCAGAGTGGGGTGGG - Intronic
1134167450 16:11941773-11941795 TGGGAGACTGAGATGGGGGAGGG - Intronic
1134380914 16:13725097-13725119 TTGGAGACTCAGAAATGGGGAGG + Intergenic
1134712775 16:16336180-16336202 TGGGGGACTGAGAAGGGGGAGGG + Intergenic
1134954052 16:18372513-18372535 TGGGGGACTGAGAAGGGGGAGGG - Intergenic
1135194772 16:20385571-20385593 TTGGAGACTCAGATGCGGGGAGG + Intronic
1135200129 16:20430030-20430052 TTGGAGACTCAGAAGGAAGAAGG + Intronic
1135218560 16:20593564-20593586 TTGGAGACTCAGAAGGAGGAAGG - Intergenic
1135312881 16:21419425-21419447 TGGGAGACTGAGATGGGGGAGGG - Intronic
1135365804 16:21851705-21851727 TGGGAGACTGAGATGGGGGAGGG - Intronic
1135446010 16:22519457-22519479 TGGGAGACTGAGATGGGGGAGGG + Intronic
1135488808 16:22889422-22889444 TTGGATTTTCAGATTGGGGATGG - Intronic
1135632434 16:24046682-24046704 CTGGAGCCTCGGGATGGGGAGGG + Intronic
1135704277 16:24661236-24661258 TGAGAGACTCAGAAGGGGAAGGG - Intergenic
1135948590 16:26889844-26889866 TTCCAGACTCAGAAAGAGGAGGG - Intergenic
1135973013 16:27086005-27086027 CTGGAGACTCAGAAGGTGGAGGG + Intergenic
1136152038 16:28357156-28357178 TGGGAGACTGAGATGGGGGAGGG - Intronic
1136168291 16:28471024-28471046 TGGGAGACTGAGATGGGGGAGGG - Intronic
1136194710 16:28644027-28644049 TGGGAGACTGAGATGGGGGAGGG + Intronic
1136211042 16:28758126-28758148 TGGGAGACTGAGATGGGGGAGGG + Intronic
1136224708 16:28851294-28851316 TTGGAGAATCAGAACTGGGGAGG - Intronic
1136255763 16:29038084-29038106 TGGGAGACTGAGATGGGGGAGGG + Intergenic
1136309547 16:29398152-29398174 TGGGAGACTGAGATGGGGGAGGG - Intronic
1136322994 16:29499933-29499955 TGGGAGACTGAGATGGGGGAGGG - Intronic
1136437678 16:30239901-30239923 TGGGAGACTGAGATGGGGGAGGG - Intronic
1136651103 16:31672076-31672098 TTAGAGACTTAGAAGGGGGAGGG - Intergenic
1137033249 16:35544182-35544204 TGGGAGATTCAGGATGGAGATGG - Intergenic
1137579060 16:49622348-49622370 GTGGGGAGTGAGAATGGGGAGGG - Intronic
1137971708 16:52991915-52991937 CTGGAGACTCAGAATGGGGAGGG + Intergenic
1138300809 16:55928404-55928426 CTGGAGACTCAGAAGGTGGAAGG + Intronic
1138719673 16:59064883-59064905 CTGGAGACTCAGAAGGGTGGGGG - Intergenic
1138938956 16:61766146-61766168 TTGGAAACTCAGAAGGGGGTAGG - Intronic
1139023924 16:62789939-62789961 TGAGAGACTCAGAAGGGGGAGGG - Intergenic
1139305913 16:65986243-65986265 TTGGAGACTCAGAAGGGAAAAGG + Intergenic
1139316736 16:66078387-66078409 TTGCAGACTCAGAAGAGGGGAGG - Intergenic
1139620848 16:68140951-68140973 TTGTAGACTCAGAAGAGGGTAGG - Intronic
1139964151 16:70736347-70736369 TCTGAGACTCAGAATGAGAACGG - Intronic
1140351563 16:74266718-74266740 TAGAAGACACAGAATGGAGAAGG - Intergenic
1140365441 16:74377389-74377411 TGGGAGACTGAGATGGGGGAGGG + Intergenic
1140705238 16:77622657-77622679 TTGGAGACTGAGAAAGGGGAAGG - Intergenic
1141030387 16:80582631-80582653 TTAGAGACTCAGAAGGAGGAAGG + Intergenic
1141867696 16:86762059-86762081 ATGGAAAATCAGAATGAGGAAGG + Intergenic
1142018508 16:87765598-87765620 GTGGAGACTCAGGAGGGGGCGGG + Intronic
1142133941 16:88443148-88443170 CTGGAGACCCAGGATGTGGACGG + Intergenic
1143588247 17:7862911-7862933 TTGGAGATTTATAAGGGGGAGGG + Intronic
1143591008 17:7885680-7885702 TTGGACAGGCAGAGTGGGGACGG + Intronic
1143863697 17:9908955-9908977 GGGGAGACAGAGAATGGGGAAGG + Intergenic
1144637498 17:16919646-16919668 TTGGAGACTCCCCAAGGGGAAGG - Intergenic
1144888168 17:18477853-18477875 GTGGGGAGGCAGAATGGGGAGGG + Intronic
1144951306 17:18995514-18995536 TTGCAGTCTCAGAAGGTGGAAGG + Intronic
1145144038 17:20466450-20466472 GTGGGGAGACAGAATGGGGAGGG - Intronic
1145240859 17:21240511-21240533 TTGGAGAATGAGGAAGGGGACGG + Exonic
1146097659 17:29947401-29947423 ATGGAGACTCAGAAGTGGGAGGG + Intronic
1146614567 17:34344618-34344640 TTGGAGATTCAGAAGGGGGAAGG + Intergenic
1146789502 17:35743377-35743399 ACAGAGACTCAGAATGGGGGTGG - Exonic
1147241639 17:39094500-39094522 TTGTAGACTCAGAGTGGGGCCGG - Intronic
1147504997 17:41007159-41007181 TTAGAGACTCAAAAAGTGGAGGG + Intergenic
1147849066 17:43427235-43427257 TTGGATACTCACACTGGGGCAGG - Intergenic
1148387015 17:47241484-47241506 TTGGAGACTCAGAAGGGGGAAGG - Intergenic
1149275350 17:55027400-55027422 TTGGAGACTCAGAAGGGGGATGG + Intronic
1151019339 17:70595997-70596019 TTAGAGTCTCAGAATGAGGTGGG + Intergenic
1151200957 17:72467787-72467809 TTGGAGGCTGACAGTGGGGAGGG - Intergenic
1151404117 17:73875847-73875869 TTGGAAACCCAGAGTGAGGAGGG - Intergenic
1153350835 18:4079521-4079543 CTGGAGACTCAGAAGTGGGGAGG + Intronic
1153361463 18:4202340-4202362 CTGGAGCCTCAGAATGAGGAAGG + Intronic
1153499597 18:5734651-5734673 CTGGAGACTCAGAAGGGTGGAGG + Intergenic
1153749492 18:8214096-8214118 TTGGAGACTCGGAGGGGGGCAGG + Intronic
1154083855 18:11282863-11282885 TTGGAGACTCAGAAGGGTGAGGG - Intergenic
1154118680 18:11633782-11633804 TGGGAGACTGAGATGGGGGAGGG - Intergenic
1154214961 18:12408739-12408761 ATGGAGACTCTGAAGGGTGAGGG + Intronic
1154962507 18:21324008-21324030 TTGGAGATTCTGAAGGGAGAAGG + Intronic
1155315134 18:24563740-24563762 ATGGAGACTCAGAAGGGGGACGG - Intergenic
1155771342 18:29704342-29704364 CTGGAGACTCAGAAGGGGGAGGG - Intergenic
1156422850 18:36974327-36974349 TTGGAGACTCAGAAGAGTGGAGG - Intronic
1157522877 18:48357276-48357298 TTGGAGGCTGGGAAGGGGGAGGG + Intronic
1158294312 18:55977936-55977958 TTGGAGATTCAGAAGGGAGGAGG + Intergenic
1158369557 18:56784434-56784456 ATGGAGACTCAGAAGGGGAAGGG - Intronic
1158554289 18:58462397-58462419 TTGGAGACTCAGAAGGAAGGTGG - Intergenic
1158768151 18:60481096-60481118 TTGGAGACTCAGAAGGAAGGAGG - Intergenic
1158904378 18:61997979-61998001 TCCGTGACTCAGAATGGAGAGGG + Intergenic
1160331894 18:78001281-78001303 TTAGAGACTCAGAAGGGGAAGGG - Intergenic
1160338071 18:78060448-78060470 TTGGAGACTCAGTCTTGGGTGGG + Intergenic
1160611204 18:80086793-80086815 TAGGAGAAGCAGGATGGGGAGGG - Intronic
1161266613 19:3367251-3367273 TTGGAGGCCCAGGAGGGGGAAGG + Intronic
1161530176 19:4784106-4784128 GTGGAGACTCAGAAGCGGGGAGG + Intergenic
1161633086 19:5369197-5369219 TAGGAGCCACAGGATGGGGAGGG - Intergenic
1161810858 19:6470450-6470472 ATGGAGACTCAGAGAGGGAAAGG - Intronic
1161921503 19:7269616-7269638 TGGGAGCCTCAGACTGGGGTTGG - Intronic
1162085029 19:8243531-8243553 TTGGATACTCTGGTTGGGGAGGG - Intronic
1162964120 19:14148018-14148040 TTGGAGACAGAGAAAGGGGAAGG + Exonic
1163162716 19:15475151-15475173 GTGGAGATTCAGAAGGGTGAGGG + Intronic
1163229300 19:15989310-15989332 CTGGAGACTCAGAAGAGGGAAGG - Intergenic
1163381941 19:16975008-16975030 TTGGAGATTCAGAAATGGGTTGG - Intronic
1163647511 19:18498193-18498215 TGGGACACTGAGAATGGGGGAGG + Intronic
1164443850 19:28300544-28300566 CTGGAGACTCAGAAGGGGGAAGG + Intergenic
1164471785 19:28542228-28542250 TGGGAGACTCAGAAGGGGGAGGG + Intergenic
1164489523 19:28693736-28693758 TTGGAGGCTCAGAATAGGCGAGG - Intergenic
1164901388 19:31928515-31928537 TTGGAGACTCAGAAGAGGGGAGG + Intergenic
1164922742 19:32101799-32101821 ATGGAGACTCAGAAGGGGGTGGG - Intergenic
1165412104 19:35668356-35668378 GTGGAGGCTCCAAATGGGGAGGG + Intronic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166381959 19:42359294-42359316 TGGGAGTCCCAGGATGGGGATGG - Intronic
1166598563 19:44072877-44072899 TTTGAGAATCAGGCTGGGGAAGG - Intronic
1166602117 19:44105674-44105696 ATGGAGACTCAAAATGGGGAGGG - Intronic
1166888747 19:45976765-45976787 TGAGAGACTCAGAAAGGGTAAGG - Intergenic
1167114076 19:47478877-47478899 TTGGAGATTCAGAAGCAGGAAGG + Intronic
1167691752 19:50989258-50989280 CTGGAGACTCAGAAGGGGGAGGG - Intergenic
1167723677 19:51196607-51196629 TTGGAGACTCAGAATGAGGAAGG - Intergenic
1167793385 19:51693966-51693988 ATGGAGACTCAGAGAGGGGGAGG + Intergenic
1168214957 19:54918608-54918630 TCAGAGTCTCAGAAGGGGGAGGG - Intergenic
1168262896 19:55206949-55206971 TTGGGGGCTGAGAATTGGGAAGG + Exonic
1168304246 19:55426375-55426397 TTGGAGTCTCAAACTGGGGATGG + Intergenic
1168429734 19:56268786-56268808 TCGGGGACTAGGAATGGGGAGGG - Intronic
1168454579 19:56496453-56496475 TTGGAGAAACTGAAAGGGGAAGG + Intergenic
925438808 2:3866394-3866416 TTGGGGCCTCAGCAAGGGGAAGG + Intergenic
926015820 2:9450443-9450465 TTTGAGCCTCAGACTGGGCACGG - Intronic
926099025 2:10101972-10101994 TTGCAGACTGGGAATGGGGGAGG + Intergenic
926198411 2:10777094-10777116 TTGCAGAGACAGAATGGGAAAGG + Intronic
926218093 2:10917651-10917673 TATGAGAATCAGAATGGGGTGGG - Intergenic
926685933 2:15697532-15697554 TTGGAGACTCAGACTTGGGTGGG - Intronic
926804880 2:16699040-16699062 TTAAAGACTCAGAAGTGGGAGGG + Intergenic
926906942 2:17814827-17814849 TTGGAGACTCAGAAGGGGGAGGG + Intergenic
926990082 2:18669671-18669693 CTGGAGACTCAGAAGGGAGGAGG - Intergenic
927049808 2:19316193-19316215 TTGGAGAGTCAGAGGGAGGAGGG - Intergenic
927144662 2:20154947-20154969 TTGGAGTCTCAGAAAGAGGTGGG + Intergenic
927399013 2:22689298-22689320 TTGGGGACACAGAATGGAGTAGG - Intergenic
927469939 2:23366158-23366180 TCAGAGGCTCAGAAGGGGGAGGG + Intergenic
928479676 2:31669264-31669286 TTTGAGACTCAGAATGGGGAGGG - Intergenic
928761110 2:34584081-34584103 TTGGAGACTGAGAAGTGGGAAGG + Intergenic
930463176 2:51710059-51710081 GTGGAGACTCAGAAGGGTGAGGG + Intergenic
930528325 2:52559784-52559806 TTAGAGACTCAGAAAGGGGAGGG - Intergenic
930539442 2:52686754-52686776 CTGGAGTCTCAGAATGGGGGAGG + Intergenic
930892919 2:56412005-56412027 CTGGAGACTCAGAAGGGTGAGGG + Intergenic
930950131 2:57131332-57131354 TTGGAGACTCAAAAAGGAGGAGG - Intergenic
932282951 2:70510400-70510422 TTGGAGAGCCAGGGTGGGGAGGG - Intronic
932803101 2:74760137-74760159 TTGGTGACTCAGAAAAGAGAGGG - Intergenic
932875062 2:75442793-75442815 TTGGAGATTCAGAAGTGGGAAGG + Intergenic
932884416 2:75535766-75535788 TTGGAGACTCAGAATGGGGAAGG + Intronic
933148446 2:78885470-78885492 TTAGAGACTTGGAAGGGGGAGGG + Intergenic
933173170 2:79146920-79146942 TTGGAGACTCAGGGTGGGGAGGG - Intergenic
933294827 2:80477515-80477537 ATGGAGACTCAGAATGGGAAAGG - Intronic
933349856 2:81139416-81139438 GTGGAGACTTAGAATGGTGAGGG + Intergenic
933904903 2:86882292-86882314 TTGGAGACTCAGAAGGAGGAGGG + Intergenic
934484794 2:94695637-94695659 TTGGAGACTCAGAGCGGGGAGGG + Intergenic
934894039 2:98097253-98097275 TTGGAGACTCAGAAGTGGGGAGG - Intronic
935476811 2:103532331-103532353 TTGGAGATTCAGAAGTGGGGAGG - Intergenic
935706301 2:105860476-105860498 TAGGCGTCTCAGAATGAGGAGGG + Intronic
935918622 2:107986188-107986210 TTGGAAGCTGGGAATGGGGAGGG - Intergenic
936367325 2:111869870-111869892 TTGGAGACTCAGAAGGAGGAGGG - Intronic
936580027 2:113691493-113691515 ATGGAGACTCAGAAGGGGGAGGG - Intergenic
936997062 2:118426734-118426756 TTAATGACTCAGACTGGGGATGG + Intergenic
937474620 2:122204105-122204127 TTGGGGAGTCACAATGGGGCAGG + Intergenic
938200821 2:129371700-129371722 ATGAAGACTCATAATGGGGAGGG - Intergenic
938526005 2:132131705-132131727 CTGTAGACTCAGAAGGGTGAGGG - Intergenic
938930626 2:136083644-136083666 TTGGACACTCGGAAGGGGGCTGG - Intergenic
939027417 2:137030758-137030780 CTGGAGACTCAGAAATGGGGAGG + Intronic
939106173 2:137951166-137951188 TTGGAGACTCAGAAGTGGAAGGG - Intergenic
939182804 2:138823828-138823850 TTGGAGACAAAGAATAGGGGTGG + Intergenic
939918717 2:148081782-148081804 ATGTAGAATAAGAATGGGGAAGG - Intronic
939946431 2:148416774-148416796 TTGGATACTCAGATGAGGGAGGG - Intronic
940545974 2:155085858-155085880 ATGCAGACTCAGAAGGAGGAGGG + Intergenic
941170419 2:162129085-162129107 TGGGAGACTGAGGTTGGGGATGG + Intergenic
941564634 2:167091298-167091320 TTGGAGTCTCAGAAGTGGCAGGG - Intronic
941622984 2:167799344-167799366 TTGGAGACTTGCAAGGGGGAGGG - Intergenic
941974398 2:171386998-171387020 TTGGGGAGTCAGAAGGGAGATGG - Intronic
942981130 2:182083408-182083430 TTGGAGACTCAGAAATGGGCAGG - Intronic
943322624 2:186464447-186464469 TTAGAGACTCAGAAGTAGGAGGG + Intergenic
943341359 2:186685736-186685758 CTGGAGACTCAGAAGTGGGGAGG - Intergenic
943483699 2:188454317-188454339 TTATAGGCACAGAATGGGGAGGG + Intronic
944082401 2:195802859-195802881 GAGGAGACTCAGAAGGGTGAAGG - Intronic
944663668 2:201941420-201941442 TTGGAGAATCTGAATAGGGCTGG - Intergenic
945075774 2:206038066-206038088 ATGAAGACTCAGAAGGGTGACGG + Intronic
945327680 2:208501550-208501572 CTAGAGACTCAGAAAGGGGGAGG - Intronic
945373916 2:209056534-209056556 TTGGAGATTCAGAAAAGGGGAGG + Intergenic
946150517 2:217764156-217764178 TTGGAGACTCAGAAGTGGGGAGG - Intergenic
946859013 2:223982306-223982328 ATGGAGACTCAGAAGGAGGAGGG + Intronic
946875029 2:224120370-224120392 TTGGAGACTCAGATGGAGGGAGG + Intergenic
946992048 2:225344493-225344515 TTAAAGACTCAGAATAGGGAGGG - Intergenic
947131508 2:226931477-226931499 TTTGAGACTCAGAAGGGGAAAGG + Intronic
947448877 2:230186660-230186682 ATGGAGACTCAGAAAGGAGAGGG - Intronic
947709090 2:232300396-232300418 CTGGAGACCAAGAGTGGGGAGGG - Intronic
947713301 2:232327932-232327954 TTTGAGACAGAGGATGGGGAGGG + Intronic
948669853 2:239561306-239561328 CTGGAGACTCAGAAAGGAGGTGG - Intergenic
948746781 2:240102205-240102227 TTAGAGACTAAGAAAGGGGAGGG + Intergenic
948908811 2:240992848-240992870 GAGGAGACTGCGAATGGGGAAGG - Intronic
1168799087 20:633240-633262 GCTGAGACTCAGAGTGGGGAAGG + Intergenic
1169083255 20:2810604-2810626 TTGGAGACTCAGAAGGAGGAGGG - Intergenic
1169323214 20:4652615-4652637 ATGGAGACTCAGAAGTGGGGAGG - Intergenic
1169416576 20:5422345-5422367 TTAGAGACTCAGAAGCTGGAGGG + Intergenic
1169513731 20:6294267-6294289 CTGGAGACTCAGAAAGGGGGAGG - Intergenic
1169766780 20:9155105-9155127 TTACAGACTCAGAAGGGGAAGGG - Intronic
1170092018 20:12599739-12599761 TTGGAGACTCAGAAAGCTGGAGG + Intergenic
1170809195 20:19660292-19660314 TTGGAGACTTAGAAGGTGGGGGG - Intronic
1170834059 20:19868691-19868713 TTGGGGACCCAGAAAGGGGAAGG + Intergenic
1170961891 20:21032835-21032857 TTGGAGACTCAGAGGTGGGGAGG + Intergenic
1170964575 20:21054908-21054930 TTGGAGACCCGCTATGGGGAAGG - Intergenic
1171211855 20:23323055-23323077 CTGGAGACTCAGAAGGGGTAGGG + Intergenic
1171374537 20:24683374-24683396 CTGGAGACTCAGAACGGTGGGGG + Intergenic
1171778495 20:29394603-29394625 ATGGAGACTCAGCAGGGTGAGGG + Intergenic
1171822552 20:29867053-29867075 ATGGAGACTCAGCAGGGTGAGGG + Intergenic
1172056091 20:32155278-32155300 CTGGGGACTCAGAAAAGGGAAGG - Intronic
1173059618 20:39648747-39648769 TTGGAGATTCAGAATGGGGAGGG + Intergenic
1173903423 20:46607643-46607665 TCTGAGACTCAGGAAGGGGAAGG - Intronic
1174204743 20:48830049-48830071 TTTGATTCTCAGATTGGGGAGGG - Intergenic
1174785887 20:53432128-53432150 CTGGAGACTCAGAAGTGGGGAGG - Intronic
1177267710 21:18805880-18805902 TTCGAGTCTCAGAATGGGGAGGG + Intergenic
1178604749 21:34025960-34025982 AGGGAGACTCAGACTGGAGAGGG + Intergenic
1178755710 21:35347479-35347501 TTGGGGACTCAGAAAGGTGAGGG - Intronic
1178901380 21:36601611-36601633 TTAGAGACCCAGGAAGGGGAGGG + Intergenic
1178917265 21:36713055-36713077 TTGGGGAGAGAGAATGGGGAGGG + Intronic
1178925849 21:36774316-36774338 GTGGAGACTCAGACAGGGAACGG + Intronic
1179056357 21:37938754-37938776 TTGGGAACTCAGGAAGGGGAAGG + Intergenic
1179095916 21:38314340-38314362 ATGGGGAGTCAGAAGGGGGATGG - Intergenic
1179130994 21:38636964-38636986 TGGGAGACTTTAAATGGGGATGG + Intronic
1179313248 21:40215640-40215662 TTGGAGACTCAGAAGTGGGGAGG + Intronic
1179523499 21:41960545-41960567 TGAGAGTCTCAGCATGGGGAGGG - Intergenic
1180324268 22:11354597-11354619 ATGGAGACTCAGAAGGGTGAAGG + Intergenic
1180435420 22:15298439-15298461 CTGTAGACTCAGAAGGGTGAGGG + Intergenic
1183343878 22:37296324-37296346 ATGGAGGCCCAGAGTGGGGAAGG - Intronic
1183899177 22:40992143-40992165 TTTGAGCCCCTGAATGGGGAAGG + Intergenic
1184804818 22:46787769-46787791 GTAGAGAACCAGAATGGGGAGGG + Intronic
950128621 3:10526799-10526821 ATAGAGACTCAGAGAGGGGAAGG - Intronic
950199374 3:11032291-11032313 CTGGAGACTCAGAAGGGTGGGGG - Intronic
950403755 3:12791437-12791459 TTGGAGATACAGATGGGGGAAGG - Intergenic
950413050 3:12851378-12851400 GTGGAGCCACAGAATGGGGGAGG + Intronic
951438519 3:22693951-22693973 TTGGAGACTCGGAAAGGGGATGG - Intergenic
951514730 3:23545989-23546011 TTGGAGACTCAGAAGAGAGGAGG + Intronic
952199010 3:31106130-31106152 CTGGAGACTCAGAAGGGTGAAGG - Intergenic
952493147 3:33891235-33891257 TTGGAGACTCAGAAGAGAGAGGG - Intergenic
952618086 3:35299896-35299918 TTAGAAACTCAGAAACGGGAGGG - Intergenic
952641651 3:35603800-35603822 TTAGAGACTCAGAAGGGGGAGGG + Intergenic
952643374 3:35625390-35625412 TTGGAGACTCAGAAGTGGGATGG - Intergenic
952749202 3:36811533-36811555 TTAGGGACTCAGAAGGTGGAGGG + Intergenic
953081239 3:39620530-39620552 TTAGAGACCCAGAAATGGGAGGG + Intergenic
953135115 3:40175508-40175530 TGGGAGTCTGAGAATGGGAAAGG - Intronic
953244223 3:41176102-41176124 TTCGAAGTTCAGAATGGGGAGGG + Intergenic
953277297 3:41514762-41514784 ATGGAGACTCAGAAGGGTGAGGG + Intronic
953278927 3:41533108-41533130 TGGGAGCCTCAGTATGGGGAGGG - Intronic
953380464 3:42467520-42467542 ATGGAGACTCAGAAGGGTGAAGG + Intergenic
954517205 3:51189418-51189440 TTAGAGACTCAGAAAGGGGAGGG - Intronic
955019541 3:55105979-55106001 ATGGAGAGTCAGCCTGGGGAGGG + Intergenic
955032548 3:55234811-55234833 TTGGAGACTCAGGAGGGGGATGG - Intergenic
955123390 3:56084690-56084712 TTGGAGACTTAGAAGCAGGAAGG + Intronic
955603856 3:60677315-60677337 CTGGAGACTCAGAATGATGATGG - Intronic
956031075 3:65038772-65038794 ATGGAGACTCAGAAGGGTGAGGG + Intergenic
956314503 3:67919515-67919537 TTGGAGACTCTGAAAGTGGGAGG - Intergenic
956390830 3:68771106-68771128 ATGGGGAGTCAGAAGGGGGATGG - Intronic
956695328 3:71914038-71914060 TTAGAGACTCAGAATGAGGAGGG - Intergenic
956856093 3:73276273-73276295 TTGGAGACTCAGAAGTAGGCTGG - Intergenic
957827605 3:85468971-85468993 TTGAAGACTCTTCATGGGGAGGG + Intronic
957959286 3:87227952-87227974 TGGCAGTCTCGGAATGGGGAGGG + Intronic
958449840 3:94259654-94259676 TTATAGGCTCAGAATGGGGAAGG - Intergenic
958811821 3:98868610-98868632 TCGGAGACTCAGAAAGGGGGAGG - Intronic
958859930 3:99434354-99434376 TTGGTGACTCAGAAGGAGAAGGG - Intergenic
958986471 3:100784868-100784890 TTAGAGACCCAGAAGGGGGAGGG + Intronic
960076204 3:113488586-113488608 TTGGAGACTCAGAAGGGGGAGGG + Intronic
960414953 3:117373246-117373268 TTGGATACTCAGAAGGTAGAGGG - Intergenic
960752283 3:120968711-120968733 TTGGATACTCAGAACGGGGGAGG - Intronic
960840883 3:121957436-121957458 TTGGAGTCTCAGAAGGGGATAGG + Intergenic
961235072 3:125359185-125359207 CTGGAGACTCAGAGTGTTGAAGG - Intronic
961339503 3:126208533-126208555 TGGAAGACACAGAATGGAGAGGG + Intergenic
961796835 3:129415214-129415236 GTGGAGGCACAGGATGGGGAGGG + Intronic
961805209 3:129484200-129484222 GTGGAGCCACAGAATGGGGGAGG + Intronic
961911160 3:130317952-130317974 TCTGAGGCTCAGAATGGGGATGG - Intergenic
961955577 3:130799608-130799630 TCAGAGACTCAGAAGGAGGATGG + Intergenic
961994431 3:131226664-131226686 TTGGAGACTCAGAAGGGAGGAGG + Intronic
962011317 3:131393777-131393799 TTGGATTCTCAGATAGGGGATGG - Intergenic
962371900 3:134827750-134827772 GCAGAGACTGAGAATGGGGAGGG + Intronic
962442483 3:135435208-135435230 TCGGAGACTCGAAATGGTGAGGG + Intergenic
962464375 3:135643005-135643027 TTGGAGTCTCACAATGAGGCGGG + Intergenic
962516192 3:136154425-136154447 TTGGAGAGTAAGAGTGGAGATGG - Intronic
963168667 3:142229952-142229974 TTGGAGACCCAGAAATGGGAGGG + Intergenic
964285581 3:155114166-155114188 TATGAGACTCAAAGTGGGGAGGG + Intronic
964629423 3:158794085-158794107 GTAGAGACTCAGAAGGGTGAAGG - Intronic
964773477 3:160249849-160249871 CTGGAGACTCAGGAAGGGGAGGG - Intronic
964976064 3:162622263-162622285 TAGGTGGCTCAGAATAGGGAGGG - Intergenic
965291351 3:166885859-166885881 TTGGAAGCTCACAATGGGTAGGG + Intergenic
965439946 3:168700058-168700080 GTGTTAACTCAGAATGGGGAAGG - Intergenic
965524566 3:169702257-169702279 TGGTGGACTAAGAATGGGGATGG - Intergenic
966464299 3:180212814-180212836 CTGGAGACACAGCCTGGGGATGG - Intergenic
967188817 3:186967764-186967786 ATGGAGGCCCAGAAAGGGGAAGG + Intronic
968857548 4:3138394-3138416 TTGGAGACTCACAAGGCGGAAGG - Intronic
969897174 4:10316274-10316296 TTGGAGACTCAGAAGGGTCATGG - Intergenic
970165722 4:13235849-13235871 TTGGAGACTCAGAAAAGGGGAGG + Intergenic
970221422 4:13815836-13815858 ATGGAGACTCAGAAGGGTGTGGG - Intergenic
970273164 4:14368493-14368515 ATGGAGAGCCAGAAGGGGGATGG + Intergenic
970576462 4:17433561-17433583 TTAGGCACTCAGAAGGGGGAAGG + Intergenic
971666577 4:29494054-29494076 TTAGACACAAAGAATGGGGATGG - Intergenic
971975679 4:33683311-33683333 TTGGAGACTCAGAATGGGGGAGG - Intergenic
972213191 4:36863235-36863257 TTGGAGACTCAGACGGGGAGAGG + Intergenic
972390251 4:38607010-38607032 ATGGGGAGTCAGAAGGGGGATGG + Intergenic
972408675 4:38769966-38769988 ATGGAGACAAAGCATGGGGAAGG - Intergenic
972446038 4:39144713-39144735 CTGGAGACTCAGAAATGGGGAGG - Intergenic
972993178 4:44847472-44847494 CTGGAGACTGAGAATGGTAAAGG - Intergenic
973192408 4:47400727-47400749 TTGGAGACTCAGAAGTGGGGAGG - Intronic
973695061 4:53482688-53482710 TTGGAGACTCAGAAAAGGGGAGG + Intronic
973712855 4:53646358-53646380 ATAGAGACTGAGAATGGGGTGGG - Intronic
974032797 4:56790990-56791012 ATGGAGACTCAGAAGAGGGAGGG - Intergenic
974490058 4:62553146-62553168 TTAGAGACTCAGAAAGGAGAGGG - Intergenic
974962980 4:68726646-68726668 TTAGAGACTCAGAAAGGAGAGGG - Intergenic
975002365 4:69240344-69240366 TTGGCGACTCTGTATGGTGAAGG + Intergenic
975290482 4:72672115-72672137 TTGGAGACTCAGAAGTGGGAGGG - Intergenic
975380823 4:73698870-73698892 TTGGAGACTCAGAGCAGGGAGGG - Intergenic
975437445 4:74369307-74369329 TTAGAGACTCAGAAGGGGAAGGG - Intronic
975905354 4:79204716-79204738 CTGGAGACTCAGAAGGGGAGTGG - Intergenic
976171927 4:82313263-82313285 TTGGAGACTCAGAAGGGGAAGGG + Intergenic
976277553 4:83292845-83292867 TTGGAGACTCAGAAGGGAAGAGG + Exonic
977198948 4:94092490-94092512 TTGGAGACTCAGAAGGTGGGAGG + Intergenic
977509533 4:97945214-97945236 TTGGAGACTTAGAAAGGGGAGGG - Intronic
977608358 4:99005905-99005927 TTGGAGACTCAGAAAGGGGGAGG + Intronic
977707636 4:100088998-100089020 CTGGAGACTCAGAACGGGAAGGG - Intergenic
977814002 4:101392265-101392287 TTAGAGACTCAGAAGTGGGGAGG + Intergenic
977910285 4:102526325-102526347 ATGGAGATTCAGAAAGGTGAGGG + Intronic
978383564 4:108156838-108156860 GTAGAGACTCAGAAGGGTGAGGG + Intronic
978529330 4:109698409-109698431 TTTGGGAGTCAGAAGGGGGATGG - Intronic
978913685 4:114097081-114097103 TTGGAGACTCAGAATGGGGAAGG - Intergenic
979281463 4:118872827-118872849 ATGGAGACTCAAAAGGGGGAGGG - Intronic
979325953 4:119379719-119379741 TGGGAGACTCAGAAGTGGGGAGG - Intergenic
979663850 4:123289172-123289194 CTGGAGATTCAGAACGGGGTAGG - Intronic
979760787 4:124401229-124401251 TTGGAGACTCAGAATAGTGGGGG - Intergenic
980105542 4:128584848-128584870 TTGGAGAATTAGACTGAGGATGG + Intergenic
980378769 4:131982129-131982151 TTGGAGACTCAGATGTGGGGAGG - Intergenic
980747638 4:137040303-137040325 TTGGAAACTCAGAATGGGGGAGG - Intergenic
980806406 4:137820295-137820317 CTAGAGACAAAGAATGGGGATGG - Intergenic
980848136 4:138348774-138348796 TTAGAGACACAGAAGGAGGAAGG + Intergenic
980907386 4:138961693-138961715 TGTAAGATTCAGAATGGGGAGGG - Intergenic
980963800 4:139501419-139501441 TCAGAGACTCAGAAGGGGGAGGG + Intronic
981126066 4:141108025-141108047 TTGGAGATTACCAATGGGGAGGG - Intronic
981166710 4:141567730-141567752 CTGTAGGATCAGAATGGGGAGGG - Intergenic
981361589 4:143852065-143852087 TTGGAGACTCAGAAGGGGGAGGG - Intergenic
981372326 4:143973046-143973068 TTGGAGACTCAGAAGCGGGAGGG - Intergenic
981381410 4:144076245-144076267 TTGGAGACTCAGAAGCGGGTGGG - Intergenic
981442782 4:144801849-144801871 TTGGAGATTCAGAAGAGGGGAGG - Intergenic
981738491 4:147977815-147977837 CTGGAGACTCCAAAAGGGGAGGG - Intronic
981786052 4:148480881-148480903 TTGGAGAGCTAGAATGTGGAGGG - Intergenic
981889768 4:149721447-149721469 CTGGAGACTCAGAAGGGAGGAGG - Intergenic
981923287 4:150110639-150110661 TTAGAGACTCAGAAGTGGGGAGG - Intronic
981954602 4:150454737-150454759 TTGGAGACTTAGAAGGGAGAAGG - Intronic
982039455 4:151381337-151381359 TTGGAGACTCAGAAGGGTATAGG + Intergenic
982076521 4:151742447-151742469 TGGGTGACTCAGAATGGAGCAGG - Intronic
982188387 4:152826458-152826480 TTGGAGACTCAGAAGAGGGGAGG + Intronic
982267369 4:153550853-153550875 TTGGAGACTCAAGATGGGGAAGG + Intronic
982422447 4:155213116-155213138 TTGGAGACTCATAAAGGAGAGGG + Intronic
982431777 4:155330889-155330911 TTGGAGACTCAGAAAGGTGGAGG + Intergenic
982765029 4:159336328-159336350 TTGGAGACTCAGAAGGGGAAGGG - Intronic
982887672 4:160802469-160802491 TTGGAGACTCAGAATGGGGATGG + Intergenic
983111642 4:163757465-163757487 TTACAGACTCAAAATAGGGATGG - Intronic
983243812 4:165264376-165264398 TGGGAGACTCAGAAGTGGGGAGG - Intronic
983400527 4:167259000-167259022 CTGGAGACTTAGAAGGGGGAGGG + Intergenic
983803623 4:171966366-171966388 TTGGTGAATGAGAGTGGGGATGG + Intronic
984321770 4:178206677-178206699 TTGGAGACTCAGAAGGGGGAAGG + Intergenic
984547809 4:181128344-181128366 TTGAAGATGCAGGATGGGGAAGG + Intergenic
984677620 4:182568374-182568396 TTGGAGAAACAGAATGAGAAGGG + Intronic
985042839 4:185909366-185909388 TTGGAGACTCAGAAGGGCTAGGG + Intronic
985141736 4:186846922-186846944 GTGGAAACTCTGAATGGGGAAGG + Intergenic
985733020 5:1561470-1561492 TTGGATAATAAGAATGTGGAGGG + Intergenic
986227897 5:5834049-5834071 ATGGAGACTCATAATAGGAAGGG + Intergenic
986328175 5:6696097-6696119 TTGAAGACTCAGAAGTGGGGAGG - Intergenic
986408586 5:7452252-7452274 TTGGAAACTCAGAAATGGGGAGG - Intronic
986435845 5:7730038-7730060 ATGGAGACTCCAAAGGGGGAAGG - Intronic
986465756 5:8021282-8021304 CTGGAGATTCAGAATGAGCAAGG - Intergenic
986539946 5:8834415-8834437 CTGGAGACTCAGAACAGGGAAGG + Intergenic
986687498 5:10287474-10287496 ATGGAGACTCAGAAGGGGGAGGG + Intronic
986879008 5:12147283-12147305 TTGAAGACTCAGAAGGGTGGGGG - Intergenic
987223576 5:15816476-15816498 TTGAAGACTCAGAAGTGGGGAGG + Intronic
987404825 5:17513966-17513988 TTAGAGACTCAGAAGTGGCAGGG - Intergenic
987412432 5:17627691-17627713 TTAGAGACTCAGAAGTGGCAGGG - Intergenic
987615573 5:20269705-20269727 TTGTAGACTTAGAAGGGTGAAGG + Intronic
988205339 5:28126516-28126538 ATGGAGAGCCAGAAGGGGGATGG - Intergenic
988348539 5:30070644-30070666 TTGGAGGCTCAGAAGTGGGGAGG - Intergenic
988889025 5:35594338-35594360 TTAGAGACTCAGAATGGGGAGGG - Intergenic
989407748 5:41080303-41080325 TTGGAGACTCAGAAGTGGGGAGG - Intergenic
989443432 5:41500411-41500433 ATGGATACTCAGAAGGGTGAGGG + Intronic
989607539 5:43258928-43258950 TTGGAGACTTAGAAGGGGTAGGG - Intronic
991325173 5:65423154-65423176 CTGGAGATTCAGAAGGGGGAAGG + Intronic
991634391 5:68689826-68689848 TTGGGGAGTCAGAGTTGGGAGGG - Intergenic
992232566 5:74677857-74677879 GTGGAGACTCAGAAAGGGGAGGG - Intronic
992403615 5:76434347-76434369 TTGGAGACTCAGAAAGAGGAGGG - Intronic
992638862 5:78751430-78751452 GAGGAGCCTCAGAATGGGAAGGG + Intronic
993165064 5:84342401-84342423 ATGGAGACTCAGAAAGGTGGGGG + Intronic
993195709 5:84742544-84742566 TTGGAGACTCAAAAGTGGGGAGG - Intergenic
993540051 5:89138136-89138158 TTGGAGACTCTGAAGGGGGAAGG - Intergenic
993628031 5:90249586-90249608 CTGGAGACTCAGAGGGGTGAGGG + Intergenic
994228350 5:97281788-97281810 ATGGAGACTCAGATGGGGGCAGG - Intergenic
994313544 5:98305497-98305519 TTGAAGACTCAGAAGTGGGAAGG + Intergenic
994388675 5:99163524-99163546 TTGGAGACTCAGAAATGGGAAGG + Intergenic
994415607 5:99466633-99466655 TTGAAAACTCAGAAAGGAGAAGG + Intergenic
994958828 5:106571460-106571482 TGGGAGACTCTGAAAGGGAAGGG + Intergenic
995320707 5:110830628-110830650 TTATAGGCTCAGAATGGGGAGGG - Intergenic
996400688 5:123059035-123059057 TTAAAGACTCAGAAGAGGGAGGG + Intergenic
996446506 5:123559174-123559196 TTAGAGACTGAGAATGGGGGAGG + Intronic
996620413 5:125495036-125495058 TTAGAGACTCAGAAGGGGAAGGG + Intergenic
997089896 5:130844438-130844460 CTGGAGACTCAGAAGAGGGGAGG + Intergenic
998228587 5:140345270-140345292 GAGGAGACTCCAAATGGGGAGGG - Intronic
999037853 5:148373609-148373631 ATAGGGACTGAGAATGGGGAGGG - Intergenic
999525333 5:152399305-152399327 TTAAAGACTAAGAATGGGGAAGG - Intronic
999575408 5:152971227-152971249 TTGGAAACTCAGAAGGAGGAGGG + Intergenic
999684811 5:154092813-154092835 TTTGAGACTAGTAATGGGGAAGG - Intronic
999923577 5:156350069-156350091 TTGGAGACTCAGAAGAGGAGAGG + Intronic
999965347 5:156803528-156803550 TTGGGAAACCAGAATGGGGAGGG + Intergenic
999981211 5:156959622-156959644 TTTGAGACTCAGATTGGGGAAGG - Intronic
1000441347 5:161267432-161267454 TTGGAGACTCAGAAGTGAGGAGG + Intergenic
1000641073 5:163702265-163702287 TTAGAGACTCAGAAGGGTGAAGG - Intergenic
1000821004 5:165983167-165983189 TTGGAGACTCTGAATGGGGGAGG + Intergenic
1000839020 5:166193129-166193151 ATGCAGATTAAGAATGGGGAAGG + Intergenic
1001166415 5:169373297-169373319 TTGGAGACTAAGAAGTGGGGAGG + Intergenic
1001214917 5:169846855-169846877 TTGGAGACTCAGAAGGGGGAGGG - Intronic
1001425399 5:171619141-171619163 TTGGAGACACAGAAAAGTGATGG + Intergenic
1001760882 5:174207150-174207172 TTGGAAACTCAAAAGGGGGAGGG + Intronic
1001822425 5:174720742-174720764 TTGCAGAGTGAGAATGGGGAAGG - Intergenic
1001895345 5:175374601-175374623 TTGGAGACTCAGAAGGAGGGAGG - Intergenic
1002520959 5:179793111-179793133 CAGGAAACTCAGAGTGGGGAGGG - Intronic
1002905736 6:1447590-1447612 CTGGAGACTCAGAAGGGGGGAGG - Intergenic
1002996931 6:2295278-2295300 TTGGAGACTGACAAGGGGGAGGG + Intergenic
1004170671 6:13293323-13293345 TTGGGGACTCAGAAGGGGGAGGG + Intronic
1004263379 6:14128329-14128351 TTGCATGCTCAGAATGGGGGTGG - Intronic
1004984079 6:21059917-21059939 GTGAAGACTCAGAAGGGGGAGGG - Intronic
1004985277 6:21074974-21074996 TTGGAGACTCAGAAGTGGGGAGG - Intronic
1005141328 6:22634881-22634903 TGGAAGACTCAGAAGGGAGAGGG - Intergenic
1005330875 6:24749042-24749064 TTTGAGACTAAGGATGGAGATGG + Intergenic
1005394866 6:25370920-25370942 TTGGTGACTCAGAAGAGGGGAGG - Intronic
1006241288 6:32681328-32681350 TTGGAGACTCAGAAGAGGGGAGG - Intergenic
1006300589 6:33191900-33191922 TTAGAGACCCTGAATGGGGATGG - Intronic
1007040357 6:38715747-38715769 TCGGAGACTCAGAAGGGGAAGGG + Intronic
1007694910 6:43725769-43725791 TGGGAGAAGCAGAACGGGGAAGG + Intergenic
1007897974 6:45382034-45382056 TTTGAGAGTCAGAATGGTAAGGG + Intronic
1008753347 6:54763644-54763666 TTGGAGCTTCAGAATTGGTAGGG + Intergenic
1009271374 6:61619262-61619284 TTAGAGACTCAGAAGGGGGAGGG - Intergenic
1009624394 6:66120542-66120564 TTGGAAACTCAGAAGGGGATAGG - Intergenic
1009709998 6:67305925-67305947 CTGGAGACTCAGAAAGGAGGAGG - Intergenic
1010073603 6:71773390-71773412 TTGGAGAAGCAGAAGGGGAAAGG - Intergenic
1010104439 6:72150148-72150170 TTATGGGCTCAGAATGGGGAGGG + Intronic
1010568991 6:77455002-77455024 TTGGAGATTTAAAATGAGGAGGG + Intergenic
1010815465 6:80353062-80353084 ATGGAGACTCAGAGAGGAGAGGG - Intergenic
1011490296 6:87884582-87884604 ATGAAGGCTCAGGATGGGGAAGG + Intergenic
1011505860 6:88043211-88043233 TTGAAGACTCAGAAAGGGGGAGG - Intergenic
1012029560 6:94041066-94041088 CTGGAGACTCAGAAGTGGGGAGG - Intergenic
1012120711 6:95363256-95363278 TCAGAGACTTAGAATGGGAAGGG + Intergenic
1012164660 6:95933238-95933260 TTAGAGACTCATAAGGGGAAGGG - Intergenic
1012700028 6:102444390-102444412 TTGGAGACTCACAAGGGAGGAGG - Intergenic
1012729698 6:102866682-102866704 TTGGAGACTCAAAAGGGGAAAGG + Intergenic
1012823142 6:104114154-104114176 ATGGAAACTCAGAATGATGAGGG - Intergenic
1012830572 6:104199518-104199540 TTGGAAACTCAGGAGGGGGTAGG + Intergenic
1012902344 6:105020708-105020730 ATAGAGACTCAGAAGGGTGAGGG - Intronic
1013380629 6:109566704-109566726 CTGGAGACTCAGAAGGGAGCAGG + Intronic
1013508649 6:110824407-110824429 CTGGAGACTCAGAAAAGGGAGGG + Intronic
1013521265 6:110935910-110935932 TACTAGAATCAGAATGGGGAGGG - Intergenic
1013806796 6:114005381-114005403 ATGGAGTCTCAGAGTTGGGAGGG + Intronic
1013858448 6:114604544-114604566 TTGGAGTCTCAGAAGTGGGGAGG + Intergenic
1014088969 6:117381394-117381416 TTGGAGACTCAGAAGGAGGGAGG - Intronic
1014092627 6:117421414-117421436 TTGGAGACTCAGAAGGGGGAGGG - Intronic
1014393648 6:120896133-120896155 TTAGAGACTCAGAAGGGGGAGGG + Intergenic
1014850905 6:126338625-126338647 CTGGAGATTGAGAATGGGGTAGG + Intergenic
1015286412 6:131490628-131490650 TAGGGGACTCAGGATGGGGCTGG + Intergenic
1015483941 6:133746765-133746787 ATGAAGACTCAGAATTGGGAGGG - Intergenic
1015499577 6:133918607-133918629 TTGGAGACTCGTAAGGGGAAAGG - Intergenic
1015636266 6:135277801-135277823 TTGGAGACTCAGAAGGGGGAAGG + Intergenic
1015916506 6:138222872-138222894 CTGGAGACTCAGAATGGGGGAGG - Intronic
1016150628 6:140737554-140737576 TTGGAGACTCAGAAAGGAGAGGG - Intergenic
1016385971 6:143531243-143531265 TTGGAGACTCAGAAAGGGGAGGG + Intergenic
1016693040 6:146961360-146961382 CTGGAGACTCAGAAGGGTAAGGG + Intergenic
1016772748 6:147870349-147870371 TTGGAGGCAGGGAATGGGGATGG - Intergenic
1017272315 6:152522213-152522235 TTGGAGACTCAGAAGGATGAGGG - Intronic
1017938360 6:159027334-159027356 TTGGAGACTCAGAATGGGGGAGG + Intergenic
1018033965 6:159866395-159866417 CTGGAGTCTGAGCATGGGGAGGG - Intergenic
1018402058 6:163433291-163433313 TTGAAGCCTGAGAAGGGGGAAGG + Intronic
1019098861 6:169610880-169610902 TTGGAGACTCACAAGGGGGCAGG + Intronic
1019391927 7:793180-793202 GTGGAGACTCAGAAGGGTGAAGG + Intergenic
1020021869 7:4874055-4874077 TTGGAGGCACGGAACGGGGAGGG - Intronic
1020560981 7:9728341-9728363 TTGGAGATTCAGAAATGGGTTGG + Intergenic
1020966944 7:14882596-14882618 ATAGAGACTCAGAAGGGAGAAGG - Intronic
1021085121 7:16413476-16413498 TTAGAGATTCAGAATGAGAAAGG - Intronic
1021466500 7:20949987-20950009 TTGGAGACTCAGAAGGTGGGAGG + Intergenic
1021498594 7:21304314-21304336 TCAGAGACCCAAAATGGGGAGGG + Intergenic
1021873132 7:25023194-25023216 TTGGAGACTCTGAAGGGGGAGGG - Intergenic
1021953391 7:25797683-25797705 TTGAAGACTGAGAATGGGATTGG - Intergenic
1022849329 7:34244154-34244176 TTGGGGACTGAAACTGGGGAAGG - Intergenic
1023795658 7:43789799-43789821 ATGGAGACTCAGGGTGGGAAAGG - Intronic
1023868849 7:44252073-44252095 TCCGAGACTCAGACTGAGGAGGG + Intronic
1023939964 7:44763020-44763042 TGGGCCACACAGAATGGGGATGG - Intronic
1024094568 7:45973720-45973742 TGGGAGACTCAGAAAAGTGAGGG + Intergenic
1024101385 7:46036119-46036141 TTGGAGACTCAGGATGTATAAGG + Intergenic
1026506927 7:70992804-70992826 TTGGAGACTCACAAATGGGCAGG - Intergenic
1027303817 7:76870697-76870719 TTAAAGACTCAGAAAGGGGTGGG + Intergenic
1027408103 7:77884388-77884410 ATGGAGACTCAGAAGGGGTAGGG - Intronic
1027528723 7:79303145-79303167 TTGGAGACTCAGAGGGTGGAAGG + Intronic
1027609709 7:80345459-80345481 ATGGAGACTCAGAAGGTGGAGGG + Intergenic
1027823996 7:83087287-83087309 TTGGAGACTCAGAAGCAGGGAGG + Intronic
1027838132 7:83272713-83272735 TCGGAGACTCAGAAGGGACAGGG - Intergenic
1027854561 7:83492946-83492968 TTGTAGACTGAGAATCTGGAAGG + Intronic
1028101209 7:86823303-86823325 TGGGATGCTGAGAATGGGGATGG - Intronic
1028123910 7:87089354-87089376 ATGGAGACTCAGAAGGGTGAGGG + Intergenic
1028264070 7:88701631-88701653 TTGAAGACTTGGAATGGTGAGGG - Intergenic
1028396104 7:90369994-90370016 TTGGAGACTCAGAGGGAGGAAGG + Intronic
1028454940 7:91028051-91028073 CTGGAGACTCAGAAGCAGGAAGG - Intronic
1028607593 7:92671969-92671991 TTGGAGACTCAGAAAGGGGGAGG + Intronic
1028967498 7:96818269-96818291 TTGGAGACTCAGAAGAGGGGTGG - Intergenic
1029173915 7:98650381-98650403 TTGGAGCATCAGAAGGGAGAAGG + Intergenic
1029410096 7:100403967-100403989 TGGGAGAAACAGAATGGGGAGGG - Intronic
1029928469 7:104344418-104344440 TTGGAGATTCAGAAGGGGAAGGG - Intronic
1030145755 7:106353161-106353183 CTGGAGACTCAGAAGTGGGGAGG - Intergenic
1030255151 7:107502170-107502192 TTGGAGATTCAGAAGAGGAAGGG - Intronic
1030991544 7:116307143-116307165 ATGGAGACTTAGAAGGGTGATGG + Intronic
1031003674 7:116447250-116447272 TTGGAGACTCAGAAGAGGGAGGG + Intronic
1031656608 7:124363917-124363939 TTAGAGACTCATAAGGGGGAGGG - Intergenic
1031714870 7:125096541-125096563 CTGGAGATTCAGAAGGAGGAGGG - Intergenic
1032814848 7:135462832-135462854 TTAGAGTTTTAGAATGGGGAGGG - Intronic
1033582858 7:142752581-142752603 TGGGAGCCTCAGCATGGGAAGGG - Intronic
1033585883 7:142774066-142774088 TGGGAGCCTCAGCATGGGAAGGG - Intergenic
1034071701 7:148192259-148192281 GTGGAGACTCAGAAGGGTGTAGG - Intronic
1035130414 7:156647352-156647374 TTGGAGACTCAGGAGGCGGAGGG - Intronic
1035138666 7:156734479-156734501 ATGGAGAGTCAGAAGGGAGAGGG + Intronic
1035343219 7:158178354-158178376 TTGGAGACTCAGAAGCGGGAGGG - Intronic
1035540376 8:430948-430970 GTGGTTACTCAGCATGGGGAAGG + Intronic
1035543755 8:462732-462754 TTGGAGACTCAGAAGAGGGAAGG + Intronic
1035672143 8:1426287-1426309 TTGGAGACCTAAAATTGGGAAGG + Intergenic
1036082139 8:5568356-5568378 TTATGGGCTCAGAATGGGGAGGG + Intergenic
1036446874 8:8829208-8829230 TGCCAGACTCAGGATGGGGAAGG - Intronic
1036576805 8:10035152-10035174 CTGGAGACTCAGAAGGGGGAAGG + Intergenic
1036612505 8:10362558-10362580 TAGGAAACTCAGAAAGGGGATGG - Intronic
1036658172 8:10691015-10691037 CTGGTGACTCAGAAAGTGGAGGG - Intronic
1036986961 8:13543828-13543850 TTGGAGACTCAGAAGAGGGGAGG + Intergenic
1037250992 8:16894065-16894087 CTGGAGACTCAGAAGGGAGGAGG - Intergenic
1038324819 8:26564927-26564949 TTGGAGACTCAGAAGAAGGAGGG - Intronic
1038333249 8:26626431-26626453 ATGGAGACACAGAATGGTAAAGG - Intronic
1038516383 8:28191016-28191038 TTGGAGACTCTGCCTGGAGAGGG + Exonic
1038908017 8:31928854-31928876 TTGGAGACTAAGAAGCGGGGAGG + Intronic
1038932233 8:32206791-32206813 CTGGAGACTCAGAAGGGTGGAGG - Intronic
1039098347 8:33911922-33911944 ATGAAGACTCAGAAGGGTGAGGG + Intergenic
1039201661 8:35101341-35101363 TTAGAGCCTCAGAAGGAGGACGG - Intergenic
1039208294 8:35182250-35182272 TTGCAGACTCAGAATGGGGGAGG + Intergenic
1039380443 8:37079941-37079963 CTGAAGAGTCAGAATGGGGCGGG + Intergenic
1039645547 8:39278265-39278287 TTATAGGCACAGAATGGGGAGGG + Intronic
1040087320 8:43358137-43358159 TTGGAGACTCAGAAGAAGGAAGG - Intergenic
1040405186 8:47094743-47094765 TTGGAGACTCAGAAGAAGAAAGG + Intergenic
1040719859 8:50306051-50306073 TTAGAGACTCAGAAGGGGGAGGG - Intronic
1040858093 8:51970768-51970790 TTGTAGACTCAGAAGTGGAAGGG - Intergenic
1040970397 8:53130002-53130024 TTGGAGACTCAGAAACAGGAGGG - Intergenic
1041166552 8:55098136-55098158 GGGGAGAGTAAGAATGGGGAAGG + Intergenic
1041310321 8:56510115-56510137 TTGGAGCCTAAGGAAGGGGAAGG - Intergenic
1041319254 8:56596363-56596385 TAGGAGACTCAGAAGGTGGGAGG - Intergenic
1041329593 8:56710460-56710482 TTGGGGACTCGACATGGGGAAGG + Intergenic
1041893551 8:62898545-62898567 TTGGAGACTCAGAAGGGAGGAGG + Intronic
1041918302 8:63157864-63157886 ATGGGGAGTCAGAAAGGGGATGG + Intergenic
1041937351 8:63348477-63348499 TTGGAGACTCAGAAGAGGCAAGG - Intergenic
1042174607 8:66026765-66026787 TGGGAACCTCAGAAGGGGGAAGG + Intronic
1042179067 8:66066709-66066731 TCGGAGACTCAGAAGGGGGAGGG + Intronic
1042267219 8:66921237-66921259 TTGGAGAATTAGAAGGGGGTGGG + Exonic
1042434771 8:68750712-68750734 TTGGAGAATCAGAATGCTTAGGG + Intronic
1042544198 8:69936156-69936178 TTGGAAGGTCAGAGTGGGGATGG - Intergenic
1042784496 8:72533329-72533351 TTGGAGACTCAGAAGGGGGAAGG - Intergenic
1042999194 8:74736582-74736604 CTTGAGTCTCAGAATGGGGCTGG + Intronic
1043074665 8:75683186-75683208 TTGGAGAGTCAGAAGCGGGGAGG - Intergenic
1043173716 8:76998155-76998177 TTGGAACCTGAGAATGTGGATGG + Intronic
1043355621 8:79408858-79408880 TTGGAGACTCAGAAGGGGAGAGG - Intergenic
1043366521 8:79539454-79539476 TTGGAGACTCAGAAGGGTAGTGG - Intergenic
1043367596 8:79553275-79553297 TTGGAGACTCAGAAGGGGAAGGG + Intergenic
1043736315 8:83749771-83749793 TTGGAGACTCAGAAGGGTAAAGG - Intergenic
1044520832 8:93197645-93197667 TTGGAATCACAGAATGGGTATGG - Intergenic
1044879529 8:96709252-96709274 TTGGAGACTCAGAAGCGGAGAGG - Intronic
1044918700 8:97145189-97145211 TTGGAGACTCAGAAGCAGGGAGG - Intronic
1045065223 8:98438063-98438085 TTGGAGGCTCAGAAGGAGGATGG + Intronic
1046232951 8:111381475-111381497 TTGGAGACTCAGAAGGGGGCAGG - Intergenic
1046238964 8:111465187-111465209 TTAGAGACTCAGAATGTGGAGGG + Intergenic
1046730569 8:117721263-117721285 TTGGAGACTCAGAAGGGTTGGGG - Intergenic
1046825875 8:118690799-118690821 TTGGAGTCTCAGAAGTGGGGAGG - Intergenic
1046873027 8:119224698-119224720 TTGGAGACTCAGGAGTGGGTGGG - Intronic
1046927890 8:119812478-119812500 TTGGAGACTCAGAAGCGGGGAGG - Intronic
1046975836 8:120276345-120276367 TTGGAGACTCAGAGTGGGGAGGG + Intronic
1046985686 8:120385801-120385823 TTGGCAACTCAGAAGGGTGAAGG - Intronic
1047022640 8:120792333-120792355 TTGGAGACTCAGAAAAGGGGAGG + Intronic
1047106078 8:121731900-121731922 TTGGAGACTCAGAAGGAAGAGGG - Intergenic
1047379629 8:124347421-124347443 TTGGAGACTTAGAATGGAAGAGG + Intronic
1047504099 8:125465224-125465246 TTGGAGACACAGAGAGGTGATGG - Intergenic
1047560282 8:125979963-125979985 CTGGAGACTCAGAATTTGGGAGG + Intergenic
1047633817 8:126737490-126737512 TTAGAGACTCAGAAGGAGAAGGG - Intergenic
1048039210 8:130709173-130709195 ATGGAGAATTAGAATGAGGAGGG + Intergenic
1049634843 8:143682118-143682140 TTATGGACTCAGAATGGGGAGGG + Intergenic
1050195411 9:3078037-3078059 TTGGATACTCAAAACGGGGAAGG - Intergenic
1050482046 9:6097483-6097505 TCTGAGGCTCAGAATGGGGAAGG - Intergenic
1050500619 9:6294298-6294320 TTGGAGATTCAGAAAGAGGAAGG - Intergenic
1050798967 9:9584830-9584852 TTGAAGACTCAGGATGGTCAAGG - Intronic
1052551488 9:29955834-29955856 ATGGAGACTCAGAATGGGGAGGG - Intergenic
1052768674 9:32667751-32667773 TTGGAGACTCAGAAGGGGGAGGG + Intergenic
1052825526 9:33171302-33171324 CTGGAAACTCAGAATGGGTTGGG + Intergenic
1052901597 9:33798633-33798655 TGGGAGCCTCAGCATGGGAAAGG - Intronic
1053107380 9:35422982-35423004 TTGGAGACTCAGAAGGGGGAGGG + Intergenic
1053324250 9:37128382-37128404 TTGGAAGCTTAGAATGTGGAAGG + Intronic
1053361023 9:37486592-37486614 AGGGAGTGTCAGAATGGGGATGG - Intronic
1053487411 9:38470431-38470453 CTGGAGACTCAGAAGGGGGAAGG - Intergenic
1053524852 9:38818032-38818054 CTGGAGACTCAGAAGCGGGAGGG - Intergenic
1053525064 9:38820818-38820840 TTGGAGACTCAGAAGGGGAAGGG - Intergenic
1053532198 9:38893854-38893876 TTGGAGACTCAGAAGCAGGAAGG + Intergenic
1053672999 9:40388733-40388755 TTGGAGACTCAGAGCGGGGAGGG - Intergenic
1053750139 9:41245072-41245094 ATGGAGACTCAGCAGGGTGAGGG - Intergenic
1053922809 9:43015102-43015124 TTGGAGACTCAGAGCGGGGAGGG - Intergenic
1054197086 9:62042448-62042470 CTGGAGACTCAGAAGCGGGAGGG - Intergenic
1054197295 9:62045240-62045262 TTGGAGACTCAGAAGGGGAAGGG - Intergenic
1054204421 9:62118263-62118285 TTGGAGACTCAGAAGCAGGAAGG + Intergenic
1054255638 9:62809411-62809433 ATGGAGACTCAGCAGGGTGAGGG - Intergenic
1054335673 9:63806196-63806218 ATGGAGACTCAGCAGGGTGAGGG + Intergenic
1054384108 9:64528799-64528821 TTGGAGACTCAGAGCGGGGAGGG - Intergenic
1054511626 9:65987550-65987572 TTGGAGACTCAGAGCGGGGAGGG + Intergenic
1054633940 9:67470101-67470123 TTGGAGACTCAGAAGCAGGAAGG - Intergenic
1054641114 9:67543442-67543464 TTGGAGACTCAGAAGGGGAAGGG + Intergenic
1054641322 9:67546246-67546268 CTGGAGACTCAGAAGCGGGAGGG + Intergenic
1054749008 9:68885670-68885692 TTGAAGACTTAGAAGAGGGAGGG + Intronic
1054880347 9:70138061-70138083 GTGGAGACTTAGAAGGGTGAGGG - Intronic
1055340091 9:75272403-75272425 TTGGAAACTCAGAAGGGGGAAGG - Intergenic
1056113435 9:83419122-83419144 TTAGAGACTCGGAAGGGGAAGGG + Intronic
1056281703 9:85047846-85047868 TTGGATACTCAGAAAGGGGGAGG - Intergenic
1056734646 9:89198431-89198453 TTAGAAACTCAGAATGGGGGAGG + Intergenic
1056819924 9:89832831-89832853 TTAGAAACTCAGAAGGGGAAGGG + Intergenic
1057635487 9:96762044-96762066 TTGGAGACTTAGGGTGGGAAGGG + Intronic
1058001330 9:99869092-99869114 TTAGAGGCCCAGCATGGGGATGG - Intergenic
1058030011 9:100185707-100185729 TTGGGGACTCAGAAAGGGGAAGG - Intronic
1058276494 9:103048039-103048061 TTAGAGAATCAGAAGGGGGAGGG + Intergenic
1058348043 9:103988003-103988025 TTGGAGACTCAGAAGTAGGTAGG + Intergenic
1058463933 9:105209617-105209639 ATGGAGACTCAGAAGGAGAAGGG - Intergenic
1058513390 9:105743950-105743972 TTGGAGAGTCAGAATATGTATGG + Intronic
1058587462 9:106525602-106525624 CTGGAGACTCAGAAGGGGGTGGG + Intergenic
1058924941 9:109653979-109654001 TTGGGAAATCAGAATGGGGTAGG + Intronic
1059302017 9:113321422-113321444 GTGGAGAATCAGAGTGGGAATGG + Intronic
1059636923 9:116180130-116180152 TTGGAGTCACAGAATGTGGATGG + Intronic
1060037044 9:120264492-120264514 TTGGACACTCAGAATAGGGGAGG - Intergenic
1060333448 9:122698167-122698189 TTGGAGACTCCGAAGTGGGAAGG + Intergenic
1060383253 9:123197505-123197527 TTAGAGACTCAGAAGAGGCACGG - Intronic
1060418478 9:123450151-123450173 GTTGAGACTCTGAGTGGGGAGGG - Intronic
1061074805 9:128334607-128334629 ATGGGGACTCAGAGAGGGGAAGG - Intergenic
1061275567 9:129568098-129568120 TTGGAGAGGAAGAGTGGGGAGGG - Intergenic
1061707189 9:132462169-132462191 TTGGAGTCGCAGAAAGGGAATGG + Intronic
1062364466 9:136202303-136202325 CTGGAGCCGCAGGATGGGGAAGG - Intronic
1203371924 Un_KI270442v1:315169-315191 ATGGAGACTCAGCAGGGTGAGGG + Intergenic
1185859566 X:3564982-3565004 TTGGAGACTCCGAAGTGGGAGGG + Intergenic
1185926441 X:4152321-4152343 TTGGACACTCAGAAGGGGGAGGG - Intergenic
1185943489 X:4347809-4347831 TTGGAGACTGGGAAAGGGGATGG + Intergenic
1185985973 X:4834112-4834134 TCAGAGACTCAGAAGCGGGAGGG + Intergenic
1185998961 X:4987314-4987336 TTGGAGACTCAGAAGCAGGAAGG + Intergenic
1186826308 X:13343548-13343570 TTGGAGACTCAGAAGGGAGGAGG - Intergenic
1186835861 X:13437159-13437181 TTGGAGACTCAGAAGGGTGAGGG + Intergenic
1187080287 X:15979042-15979064 CTGGAGACTCAGAAAGGGGGAGG + Intergenic
1187206523 X:17186911-17186933 TTGGAGACTCAGAAGCAGGGAGG + Intergenic
1187435537 X:19265404-19265426 TCAGAGACTCAGAAGGTGGAGGG - Intergenic
1187551766 X:20313123-20313145 TTGGAAACTCAGAAGAGGGGAGG - Intergenic
1187586657 X:20669993-20670015 TTGGATACTCAGAAGGGGGAAGG - Intergenic
1187675276 X:21710387-21710409 TTAGAGCCTCAGAAGGGGAAGGG + Intronic
1187716601 X:22108342-22108364 TTGGAGACTCAGAAGCAGGGAGG + Intronic
1188101032 X:26088163-26088185 TTAGAGATTCAGAAAGGGGAGGG + Intergenic
1188154577 X:26725021-26725043 TTGGAGACTCAGACATGGGGAGG - Intergenic
1188158741 X:26774966-26774988 ATGGAGACTCAGAAAGGGGAAGG + Intergenic
1188188771 X:27148250-27148272 TTGGAGACTCAAAAAGTGGGAGG + Intergenic
1188206828 X:27370206-27370228 TTGGAGACTCAGAAACAGAAGGG + Intergenic
1188780209 X:34273961-34273983 TTGGACACTCAGAAAGGTGAGGG - Intergenic
1188964293 X:36531897-36531919 TTGGAGACTCAGAAAGCGTTGGG - Intergenic
1189167478 X:38874955-38874977 TTGAAGACTCAGAATGGGGGAGG - Intergenic
1189237580 X:39499558-39499580 TTGGAGACTCAGAAGTGGGGAGG - Intergenic
1189434985 X:40984532-40984554 TTGGAGACTTGGAAGAGGGAGGG + Intergenic
1189507582 X:41627561-41627583 CTAGAGACTCAGAATAGGGGAGG - Intronic
1189607026 X:42689720-42689742 TTGGAGGCTCAGAAGTGGGGAGG - Intergenic
1189817645 X:44839988-44840010 TTGGAGACTCATAATGGGCGAGG + Intergenic
1189971384 X:46421343-46421365 TTATGGACTCAGAATGGGGAGGG - Intergenic
1190056340 X:47183215-47183237 ATGGAGACTCAAAAGGTGGAGGG + Intronic
1190705576 X:53024147-53024169 TTATGGACTCAGAATGGGGAGGG - Intergenic
1191673177 X:63768135-63768157 TTGGAGACTCAGAAGGGGAAGGG - Intronic
1191834546 X:65449839-65449861 TTGGAGACTCAGAAGCATGAGGG + Intronic
1192058408 X:67797531-67797553 TTGGAGACTAAGAAGGGGGAGGG + Intergenic
1192097084 X:68223534-68223556 TTGGAGACTCAGAAAAAGGGTGG + Intronic
1192265650 X:69535834-69535856 TTGCAGCCTCAGCATGGGCAAGG + Intergenic
1192284389 X:69719505-69719527 TTGGAGACTCAGAAGTGGGGAGG - Intronic
1192884445 X:75321994-75322016 TTGGAGACTGAGAAGGGGTAGGG - Intergenic
1193187515 X:78530448-78530470 TTAGAGACTCAGAAGGGGGAGGG - Intergenic
1193405491 X:81096014-81096036 TTGGAGATGCAGAAGGGGTAAGG + Intergenic
1193460316 X:81783798-81783820 TTAAAGACTCAGAAGGGGGAGGG - Intergenic
1193470943 X:81902571-81902593 TTGGAGACTCAGAAGGGGGAGGG - Intergenic
1193574170 X:83179058-83179080 TTGGAGAATAATAAGGGGGATGG - Intergenic
1193617174 X:83703485-83703507 TTGGAGACTCAGAAGTAGGAGGG - Intergenic
1193979184 X:88159897-88159919 ATGGAGACTCAGAATGATGGTGG - Intergenic
1194047497 X:89026546-89026568 TTGGAGACTCAGAAGAGAGGAGG - Intergenic
1194088515 X:89558244-89558266 TTAGAGACTCAGAAGGGGGAGGG + Intergenic
1194089909 X:89572931-89572953 TTAAAGACTCAGAAGGGGGAGGG - Intergenic
1194145648 X:90258690-90258712 TTGGAGATTCAGGAGGGGGAAGG + Intergenic
1194228439 X:91291606-91291628 TTGGAGACTCAGAAGTGGGTAGG - Intergenic
1194453931 X:94079529-94079551 TTGGAGACTCAGAAGCAGGGAGG - Intergenic
1194465139 X:94225357-94225379 TTGGAGACTCAGAAACGGTGAGG + Intergenic
1194597336 X:95874658-95874680 TTAGAGTCTCAGAAGGGAGAGGG + Intergenic
1194615312 X:96093651-96093673 TTGGAGACTCAGAAGGGAGGAGG + Intergenic
1194695109 X:97038013-97038035 CTGGAGACTCAGAAGGGGGTAGG - Intronic
1194946506 X:100074663-100074685 TTGGAGAATTGGAAGGGGGAGGG + Intergenic
1195002055 X:100651340-100651362 TTTGAGAACCAGAAAGGGGAGGG + Intronic
1195010283 X:100726931-100726953 ATGGAGACTCAGAAGGGTGAGGG - Intronic
1196557934 X:117112704-117112726 TTGGAGACTCAGAAGCAGGAGGG + Intergenic
1196796847 X:119508749-119508771 CTAGAGACTCAGAAAGGGGAGGG - Intergenic
1197048661 X:122031291-122031313 TTAGAGACCCAGAAGGAGGAGGG - Intergenic
1197121236 X:122895425-122895447 TGGGAGACTCAGGTTGGGGTGGG + Intergenic
1197163299 X:123347612-123347634 ATGGAGCCTCCGAGTGGGGAGGG - Intronic
1197571314 X:128154156-128154178 TTGGAGACTCAGAAGTAGGAGGG + Intergenic
1197618410 X:128719967-128719989 ATGGAGACTCAGAAGGAGGATGG - Intergenic
1197645952 X:129016681-129016703 TTGGAGACTCAGAAGGGGGTAGG - Intergenic
1197987602 X:132283612-132283634 TTGGCGTCTCAGAAGGGGGAAGG - Intergenic
1198038327 X:132823431-132823453 TTAGAGACTCAGAAGGAGGAGGG - Intronic
1198134421 X:133733273-133733295 TTAGGGACTCAGAAGGGGGAGGG + Intronic
1198166788 X:134065428-134065450 TTGGAGAGGCAGTGTGGGGAGGG - Intergenic
1198319684 X:135507590-135507612 TTGGCGACTCAGAAGTGGGGAGG - Intergenic
1198417189 X:136432612-136432634 CTGGAGACTCAGAAGGGGGAAGG - Intergenic
1198661753 X:138976533-138976555 ATAAAGACTCAGAAGGGGGATGG + Intronic
1198676451 X:139136354-139136376 TTAGAGACTCAGAACGGGGAGGG - Intronic
1198740893 X:139841635-139841657 CTGTAGTCTCAGCATGGGGATGG - Intronic
1199010842 X:142756738-142756760 TTGGAGACACAGAGAGGGGAGGG - Intergenic
1199078096 X:143546956-143546978 TTAGAGACTCAGAAGGGGGAAGG + Intergenic
1199110821 X:143931843-143931865 TTGGAGATTCAGAAGGGGAAGGG - Intergenic
1199242274 X:145561180-145561202 TTGGAGACTTAGAAGGGGAAGGG + Intergenic
1199326733 X:146507430-146507452 TTGGAGAATCAGAAGGGGAGAGG + Intergenic
1199865216 X:151841198-151841220 TTACAGTCTCAGAATGGGGAAGG + Intergenic
1200010001 X:153113745-153113767 TTTGAGAACCAGAAGGGGGAAGG - Intergenic
1200029599 X:153286177-153286199 TTTGAGAACCAGAAGGGGGAAGG + Intergenic
1200353995 X:155528489-155528511 CTGGAGACTCAGAAGGGGAGAGG - Intronic
1200377259 X:155796259-155796281 TTGAAGACTCAGAAAGGGGGAGG - Intergenic
1200441191 Y:3214291-3214313 TTAGAGACTCAGAAGGGGGAGGG + Intergenic
1200442560 Y:3228985-3229007 TTAAAGACTCAGAAGGGGGAGGG - Intergenic
1200491400 Y:3827990-3828012 TTGGAGATTCAGAAGGGGGAAGG + Intergenic
1200794309 Y:7326496-7326518 CTGGAGACTCAGAAGTGGGGAGG + Intergenic
1201066423 Y:10099957-10099979 ATGGAGACTCAGGAGGGTGAGGG - Intergenic
1201398708 Y:13578624-13578646 TTGGAAACTCAGAATAGGGAAGG + Intergenic
1201474833 Y:14369228-14369250 CTGGAGACTCAGAATCTGGGAGG + Intergenic
1201761461 Y:17543930-17543952 ATGGAGACTCAGCAGGGTGAGGG + Intergenic
1201840091 Y:18362060-18362082 ATGGAGACTCAGCAGGGTGAGGG - Intergenic
1202033491 Y:20605058-20605080 TTGGGGACTCAGAATGTAGGAGG + Intergenic