ID: 919493779

View in Genome Browser
Species Human (GRCh38)
Location 1:198238330-198238352
Sequence CTCCTTTTTCAGAGGGGCAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 250
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 227}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919493771_919493779 21 Left 919493771 1:198238286-198238308 CCACAAACTTCTCCATCCACAAT 0: 1
1: 0
2: 3
3: 31
4: 290
Right 919493779 1:198238330-198238352 CTCCTTTTTCAGAGGGGCAAGGG 0: 1
1: 0
2: 0
3: 22
4: 227
919493774_919493779 -3 Left 919493774 1:198238310-198238332 CCTCTTCTAGAACACTACTTCTC 0: 1
1: 0
2: 0
3: 15
4: 155
Right 919493779 1:198238330-198238352 CTCCTTTTTCAGAGGGGCAAGGG 0: 1
1: 0
2: 0
3: 22
4: 227
919493772_919493779 9 Left 919493772 1:198238298-198238320 CCATCCACAATGCCTCTTCTAGA 0: 1
1: 0
2: 3
3: 24
4: 202
Right 919493779 1:198238330-198238352 CTCCTTTTTCAGAGGGGCAAGGG 0: 1
1: 0
2: 0
3: 22
4: 227
919493773_919493779 5 Left 919493773 1:198238302-198238324 CCACAATGCCTCTTCTAGAACAC 0: 1
1: 0
2: 0
3: 17
4: 160
Right 919493779 1:198238330-198238352 CTCCTTTTTCAGAGGGGCAAGGG 0: 1
1: 0
2: 0
3: 22
4: 227

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919493779 Original CRISPR CTCCTTTTTCAGAGGGGCAA GGG Intronic
902044698 1:13515462-13515484 CTGCTTTTGCAGAGTTGCAAGGG - Intergenic
902853314 1:19179170-19179192 CTCCTTTTTCTGAGGGCCCTTGG - Exonic
903483295 1:23670282-23670304 CTCCTGGTCCAGATGGGCAAAGG + Intergenic
905976827 1:42181671-42181693 CTCCCTGTTAAGAGGGGCTAGGG - Intronic
906210775 1:44011211-44011233 ATCCTTACCCAGAGGGGCAAGGG - Intronic
909477427 1:76096229-76096251 TTCTGTTTTCAGAGAGGCAAGGG + Intronic
910061219 1:83094971-83094993 CTTCTTTATGAAAGGGGCAATGG + Intergenic
910720880 1:90285052-90285074 CTCATTTTTTAGAGGACCAATGG + Intergenic
911189351 1:94932458-94932480 CCCTTTTTTGAGGGGGGCAAGGG + Intergenic
911740393 1:101380609-101380631 ATCCATTTTCAAAGGGGAAATGG + Intergenic
912583918 1:110744564-110744586 CTCCTTTTGGAGAGAAGCAAGGG + Intergenic
913075746 1:115338929-115338951 CTACAGTTTCAGAGGGGCCAAGG - Intergenic
914785814 1:150829619-150829641 CTTCTTTTGTATAGGGGCAAAGG + Intronic
916475978 1:165169314-165169336 CTCCTTCTGCACAGGGGCACAGG + Intergenic
918021125 1:180692125-180692147 CTACATTTTCAGCTGGGCAAAGG + Intronic
918540301 1:185625094-185625116 ATCCTTTTTCATAGGGGAAGGGG + Intergenic
919493779 1:198238330-198238352 CTCCTTTTTCAGAGGGGCAAGGG + Intronic
919863206 1:201757173-201757195 CTGCTTTTTCAGATGTTCAATGG - Intronic
920022111 1:202964173-202964195 TTCCTTTTACAGAGAGACAATGG - Intronic
920579462 1:207091799-207091821 CTACTTTTGCAGATGGGAAAGGG - Exonic
924382175 1:243475021-243475043 CACCTTTTACAGAGGTGCATTGG - Intronic
924503583 1:244659548-244659570 CTCCATCTTCAGACCGGCAATGG + Intronic
1065270436 10:24027171-24027193 TTCCTAGTTCAGAGAGGCAAAGG - Intronic
1065975307 10:30836472-30836494 TCCCTTTTCCAAAGGGGCAAAGG + Intronic
1066124780 10:32330145-32330167 TTCCTTTTTCAAAGGGCCACTGG + Intronic
1067539057 10:47138400-47138422 CTCCTCTTCCAGAAGGGCCAAGG - Intergenic
1069063153 10:63914942-63914964 CTCCCTTTTCAGAGGAGCATGGG + Intergenic
1069074329 10:64022071-64022093 CTCCTTTATCTGAGGAGAAATGG - Intergenic
1072696683 10:97609200-97609222 CTTCGTTTTCAGAGGTGCACTGG - Intronic
1073472750 10:103733247-103733269 CTCCTGATTCAGAGGGGCTCTGG - Intronic
1074386397 10:113019999-113020021 CTGCTTTTAAAGAAGGGCAAAGG - Intronic
1074889436 10:117722843-117722865 CTCCTTTTGCAGATGGTGAAAGG + Intergenic
1075414469 10:122252302-122252324 CTCATTTTTCAGTGAGGAAATGG - Intronic
1076215706 10:128692091-128692113 GTCCTTTTCCAGAGGAGGAAAGG + Intergenic
1076646293 10:131957316-131957338 CTCCTTCTCCACAGGGGCACAGG - Intronic
1078543840 11:12232000-12232022 CTCATTTTTCAGACAAGCAAAGG - Intronic
1079248293 11:18769328-18769350 CTCATTTGTGGGAGGGGCAAGGG + Intronic
1079660934 11:23035705-23035727 CTGCTTTTTCACAAGGGCAGAGG - Intergenic
1080392350 11:31860220-31860242 CTCAATTTTCAGAGGGGCTCAGG + Intronic
1083577089 11:63799825-63799847 CTAATTTTTTAAAGGGGCAAAGG + Intergenic
1085198353 11:74685653-74685675 CTCCTTCTTGAAAGGGGAAATGG + Intergenic
1085714586 11:78861320-78861342 CTCCTTTTGAAGAGGAGAAAAGG + Intronic
1085750170 11:79154711-79154733 CTCCTTCCTCTGAGGGGCCAAGG - Intronic
1086246640 11:84761051-84761073 CTGCTTTTTCACAAGGGCAGAGG - Intronic
1087568650 11:99895842-99895864 CTCCTTTCTCAGTGGGGCAGTGG - Intronic
1090401651 11:126453093-126453115 CTCCACTTTCAGAGGGGCTGGGG - Intronic
1096486222 12:51983327-51983349 CTCATCCTTCAGAGGAGCAATGG - Intronic
1096666545 12:53170116-53170138 TTTCTTTTTCAGAGGGAAAATGG - Exonic
1097232674 12:57522207-57522229 CCCCATTTTCAGAGAGGAAATGG - Intronic
1099442508 12:82715379-82715401 CCCCTTTTTCTTAGGGGAAAAGG + Intronic
1102448128 12:113019351-113019373 CACATTTTACAGAGGGGGAAAGG + Intergenic
1104386411 12:128355191-128355213 CTCCATTTTCACAGGGGCACTGG + Intronic
1105634294 13:22202485-22202507 CTCATTTTACAGAGAGGAAAAGG + Intergenic
1105727782 13:23182841-23182863 CTCCTTTTCTAGAGGTTCAAAGG - Intronic
1106151737 13:27110461-27110483 CTCCTGTTTCAGTGGGGCAGAGG - Intronic
1108507673 13:51127353-51127375 CCCATTTTTCAGAAGGGAAATGG + Intergenic
1110089294 13:71424885-71424907 CTCCTTCTCCAGAGGGTCTATGG + Intergenic
1110599071 13:77350873-77350895 CTCATTTTTCTGAGGGGTGATGG + Intergenic
1111852631 13:93596198-93596220 ATCCTTATTGAGAGGAGCAATGG + Intronic
1112018696 13:95352924-95352946 CACCCTTTTCATAGGGGAAAGGG + Intergenic
1112562906 13:100529586-100529608 CTCCATTTTCTGAAGGGAAATGG - Intronic
1112618107 13:101026372-101026394 CTCCTTTTACAGAAGAGAAAAGG + Intergenic
1113138439 13:107119351-107119373 CTAATTGTTAAGAGGGGCAAGGG - Intergenic
1113801885 13:113090983-113091005 CTCCTTTTTCATCGGTGGAAAGG + Intronic
1119206255 14:72796200-72796222 CTCCTTTTATAGATGGGGAAAGG - Intronic
1119214221 14:72856284-72856306 CTCCTGTTTTAGAGGAGAAAAGG - Intronic
1119768266 14:77204399-77204421 CTCCTTCCACAGAGGGACAAAGG - Intronic
1120530512 14:85625443-85625465 CTGCTTATTCTGAGGGACAAGGG - Exonic
1122105243 14:99448197-99448219 CTCATTTTTCAAATGGGGAATGG - Intronic
1124487067 15:30127673-30127695 CTCCGTTTACAGATGGGCCAAGG + Intergenic
1124542152 15:30596648-30596670 CTCCGTTTACAGATGGGCCAAGG + Intergenic
1124756458 15:32410650-32410672 CTCCGTTTACAGATGGGCCAAGG - Intergenic
1126105550 15:45144756-45144778 CTCCTTTTACAGAAGAGGAAAGG - Intronic
1126368050 15:47916635-47916657 CCCCTGTTTCAGAGAGGCAGTGG + Intergenic
1126446230 15:48747795-48747817 TCCCTTCTTCAGAGGGGCACTGG + Intronic
1130159308 15:81383150-81383172 CTACTATTTCAGAGGTGCATGGG - Intergenic
1131189885 15:90306010-90306032 CTCCTCAATCAGAGGGACAAAGG + Intronic
1134665050 16:16012720-16012742 CTCTTTTTTCCCAGGCGCAATGG + Intronic
1134674733 16:16082038-16082060 GGGCTTTATCAGAGGGGCAAGGG - Intronic
1135034203 16:19062990-19063012 ATCCTTGCTCAGAGGAGCAAAGG + Exonic
1135469143 16:22713471-22713493 CACCTTTTCCAGAAGGGTAATGG + Intergenic
1135940816 16:26820117-26820139 CTCCTTTTACAGATGGGGAAAGG - Intergenic
1138221253 16:55252629-55252651 CTAATTTTTCAAATGGGCAAAGG + Intergenic
1138521100 16:57571260-57571282 CTTCGTTTTCACAAGGGCAAGGG + Intronic
1138685441 16:58721181-58721203 CTGGCTTTTCAGAGGGGGAAGGG + Intronic
1139299843 16:65935628-65935650 CTCCTTTTTCCGAGTGGTCAGGG + Intergenic
1139589266 16:67924422-67924444 CTCCATCTTCAGAGTGGCACAGG - Intronic
1142421832 16:89975631-89975653 CTACTTTCTCAGATGGGCAATGG + Intergenic
1144437425 17:15254326-15254348 CTCGTTTGTCAGAGGCGCCAGGG - Intronic
1145739610 17:27262214-27262236 CTCCATTTTCAAAGGTGAAATGG - Intergenic
1145772397 17:27502841-27502863 TTTCTTTTTCAGAGAGCCAAGGG - Intronic
1146032146 17:29375446-29375468 CTCATTTTACAGATGGGGAAAGG + Intergenic
1149591146 17:57830853-57830875 CTCCATTTTCAGATGGGAAAAGG - Intergenic
1149983921 17:61332914-61332936 CTCCTTTTTAAGATGGGGATAGG - Intronic
1150337800 17:64343097-64343119 CTCCTTTTACAGATGGGGAAAGG + Intronic
1150510134 17:65743173-65743195 CTCTTCTTTCAGAGAGGAAATGG + Exonic
1151029782 17:70723206-70723228 ATTATTTTTCAGAGGGGTAAAGG + Intergenic
1151361520 17:73592144-73592166 TTCCTTTTTCTGTGGTGCAAGGG - Intronic
1152129421 17:78467051-78467073 GGCCTTTTTTAGAGAGGCAAGGG - Intronic
1156491141 18:37496936-37496958 CTCATTTTTCAGAGGGGTAGGGG + Intronic
1163941883 19:20502674-20502696 CTCCTGGTTGAGTGGGGCAATGG + Intergenic
1164288979 19:23850105-23850127 CTCCTGGTTGAGTGGGGCAATGG + Intergenic
1165876291 19:39009617-39009639 CTCAGTTTTCAAATGGGCAAAGG - Intronic
1166892448 19:46001715-46001737 CTCTTTTCTCAGAGGCCCAAGGG - Intronic
1167126914 19:47555779-47555801 CTTCATTTTCAGAGAGCCAAGGG - Exonic
925069398 2:954719-954741 CTTCTTGTTCAGAGGGGCAGGGG - Intronic
926165700 2:10521328-10521350 CAGCCTTATCAGAGGGGCAAGGG + Intergenic
926315847 2:11708953-11708975 CCCCTTTTATAGAGGGGAAATGG + Intronic
926535709 2:14108813-14108835 CTCATTTTTCAGAGGACAAATGG + Intergenic
927012115 2:18914672-18914694 TTGCTTTTTCAGAGCTGCAAAGG - Intergenic
927802031 2:26109807-26109829 CTCCTACTACAGAGGCGCAATGG + Exonic
928580132 2:32699057-32699079 CTTCTTTTACAAAGGGACAAGGG - Intronic
932277060 2:70459567-70459589 CTCCTTGCTCAGTGTGGCAAGGG + Intronic
932597450 2:73102873-73102895 CTCATTTTACAGAGGTGAAATGG - Intronic
932706074 2:74026105-74026127 CTGGTATTACAGAGGGGCAAAGG - Intronic
933580988 2:84126536-84126558 CTCCTCTTTCAGAGGGACAGGGG + Intergenic
937049245 2:118875190-118875212 CTGCTGTTTAAGAGTGGCAAGGG + Intergenic
937309206 2:120891787-120891809 CTGCTTTTTCAGTGGGGTCAGGG - Intronic
938420226 2:131139827-131139849 ATCATTTTACAGATGGGCAAAGG + Intronic
940007165 2:149018519-149018541 ATCCTTTTTAAGAGGAGAAAAGG - Intronic
940027300 2:149221922-149221944 CTACTTTTTGAGTGAGGCAAGGG + Intergenic
940046414 2:149415348-149415370 CTCCTTTTTCAGCCAGGCAGAGG - Intronic
941359241 2:164531631-164531653 CTCCTTTCTCAGAGGGCAGAGGG - Intronic
943235326 2:185310657-185310679 ATCCTTTTTGAGAGGCGCTAGGG + Intergenic
943417422 2:187625859-187625881 CTCATTTTTCAGATAGGAAATGG + Intergenic
946538407 2:220657412-220657434 CTGCCTTTTCACAAGGGCAAAGG + Intergenic
948827206 2:240578478-240578500 CTCCCTGTTCTGAGGGGCTAAGG - Exonic
1169580665 20:7020167-7020189 GTCCTTTTTTTGAGGGGCAGGGG - Intergenic
1170795914 20:19546605-19546627 CTCCTTTTTTTGAGGGGAAAGGG + Intronic
1172060108 20:32181650-32181672 CTCCATTTTAAGAGGAGCCATGG + Intergenic
1172771997 20:37387291-37387313 CTGCCTTCTCAGAGGGGCAAAGG + Intronic
1175865797 20:62175755-62175777 CTCCTTCTTCAAGAGGGCAAAGG + Intronic
1176996369 21:15560002-15560024 ATCCTTTTTCACAGGGGAGAGGG + Intergenic
1177303698 21:19284692-19284714 CTCTTTTTTCAGAGGGGAAGGGG + Intergenic
1178050765 21:28744556-28744578 CTCCTGTTTCATAGTAGCAAAGG + Intergenic
1178149101 21:29773916-29773938 CACTTTTTTCAGACGGGAAAGGG - Intronic
1178149949 21:29782476-29782498 TTGATTTTTCAGAAGGGCAAGGG + Intronic
1178475338 21:32932860-32932882 ATCCTTTTTCAGAAGGAGAAAGG - Intergenic
1179623837 21:42636338-42636360 CTCCTTGGTCAGAGGGGCCGAGG + Intergenic
1179722172 21:43322037-43322059 CTCCCTCTTGAGAGGGGCATGGG + Intergenic
1182658135 22:31905927-31905949 CTCCTTAGTTAAAGGGGCAAGGG - Intronic
1183258221 22:36776835-36776857 CTCCTTTTGCAGAGAGTAAATGG - Intergenic
1183319400 22:37155929-37155951 CCCCTCTTTCACAGGGGCCATGG + Intronic
1185393845 22:50577032-50577054 CACCTATTGGAGAGGGGCAAGGG + Exonic
949393314 3:3587369-3587391 CTCCATTTGCAGAAGGGGAATGG - Intergenic
949903052 3:8835785-8835807 CTCCCTCTTCAGAGGGCTAAGGG - Intronic
949985125 3:9534559-9534581 CTCCTTCTAAAGAGGGGCATTGG + Intronic
950494887 3:13327841-13327863 CCCATTTTTCAGAGGAGGAAAGG - Intronic
950865563 3:16186115-16186137 CTCCATTTTAAAATGGGCAAAGG + Intronic
950923556 3:16717850-16717872 CTCCTGTGTCTAAGGGGCAATGG - Intergenic
951085842 3:18511607-18511629 CTCCTTTTTCACAGTGGCTCAGG + Intergenic
951901083 3:27658271-27658293 CTCCTTTTCCAGATGAGGAAAGG + Intergenic
953311436 3:41883942-41883964 CTCCATTTACAGACGGGCCAAGG - Exonic
954371956 3:50173720-50173742 CCCCTTTATCAGAGGGGGTATGG + Intronic
954966918 3:54620038-54620060 CCCATTTTTCAGAGGCTCAAAGG - Intronic
955348752 3:58179264-58179286 CTCCTTTCCAAGTGGGGCAATGG - Intergenic
956968629 3:74494274-74494296 GTGTTTTTTCAGTGGGGCAAGGG - Intronic
957307572 3:78477905-78477927 ATCTTTTTTCAGAGGGGGAAGGG - Intergenic
958782484 3:98559428-98559450 CTCCTTTTAAAGGTGGGCAAAGG + Intronic
960925233 3:122789114-122789136 CTCATTTTTAAAAGGGGCAAAGG - Intronic
961682666 3:128609202-128609224 CTCATGTTTCAGAGGGGAAATGG - Intergenic
962503334 3:136018477-136018499 CTTCGTTTTCAAAGGGGGAAGGG + Intronic
963077204 3:141358180-141358202 CTACTAATTCAGAGGTGCAAGGG + Intronic
965060397 3:163778016-163778038 TTCCTTCTTCAGAGGGGATAAGG - Intergenic
966607573 3:181836719-181836741 ATCCTTTTTGATGGGGGCAAAGG - Intergenic
966710939 3:182972474-182972496 CTCCTTTTTAAGAGGTGCTGAGG + Intronic
968182622 3:196607884-196607906 CTCATTTTTTAAATGGGCAAAGG - Intergenic
970310562 4:14778082-14778104 CTCCATTTTCAGAGGGAAATGGG - Intergenic
970727848 4:19068050-19068072 CTTCTTATTCAGAAGGGCAAGGG + Intergenic
973082244 4:46008348-46008370 TTCCTATTTCAGAGAAGCAAAGG - Intergenic
974605359 4:64144088-64144110 CTCCTGGTTGAGCGGGGCAATGG + Intergenic
975543884 4:75541982-75542004 CTCATTTTTCAGAGATGAAATGG - Intronic
978164974 4:105596297-105596319 CCGCTTTTTCAAAGGAGCAAGGG + Intronic
980566806 4:134552905-134552927 CTCTGATTTCAGAGGGCCAAAGG - Intergenic
980978724 4:139635727-139635749 CTCCTGGTTGAGCGGGGCAATGG - Intergenic
984388259 4:179092830-179092852 CTGCTTTTCCAGAGGGGTATGGG + Intergenic
985368062 4:189254699-189254721 CTTCTTTGTAAGAGGAGCAAAGG + Intergenic
986145658 5:5074955-5074977 AACCTTTTTCACAGGGGAAAGGG - Intergenic
986842311 5:11711839-11711861 CTCATCTTTCAGATGGGCATGGG + Intronic
986980762 5:13446179-13446201 CTGATTTTTCACATGGGCAATGG - Intergenic
987504808 5:18754218-18754240 CTACCTTTTCACAAGGGCAAAGG + Intergenic
989318653 5:40110056-40110078 CTCCTGGTTGAGAAGGGCAATGG - Intergenic
990251284 5:53917797-53917819 CTCCTTCACCAGAGGGGTAAAGG + Intronic
990519892 5:56569044-56569066 TTCATTTATCAGATGGGCAAAGG + Intronic
991455991 5:66805147-66805169 CTCATTTTTCAAAGGAGTAAAGG + Intronic
992917588 5:81474144-81474166 CTCATCTTTCAGATGGGCTAAGG + Intronic
993361069 5:86977088-86977110 TTCCTTTTATAGAGGGGCTAGGG + Intergenic
993730568 5:91417238-91417260 TTCCTTCTTCAGAGTTGCAAAGG + Intergenic
995492675 5:112708854-112708876 CTCCTTTATTAGTGGAGCAAGGG + Intronic
996627370 5:125586354-125586376 CTGCTTTTTCACAAGGGTAAAGG - Intergenic
996852261 5:127966363-127966385 CTGCTTTTTCACAAGGGCAAAGG + Intergenic
999435558 5:151560598-151560620 CTCCTTCTTCTGAGTGGCCAGGG + Intronic
1001308023 5:170589977-170589999 CCCATTTTGCAGAGGGGGAAAGG - Intronic
1004705214 6:18118236-18118258 CTCATTTTTCTGAGGTGCACAGG + Intergenic
1006765876 6:36506283-36506305 CTCCATTTTCATAGTGGTAAAGG - Intronic
1007582430 6:42967449-42967471 CTGCTCTGTCAGAGGGGCAGCGG - Exonic
1007868420 6:45002904-45002926 CTTCTCTTTCAGTTGGGCAATGG - Intronic
1010183391 6:73114716-73114738 CTGCTTTTTGAAAGGGGTAATGG - Intronic
1010492174 6:76489530-76489552 CTCCTGGTTGAGTGGGGCAATGG + Intergenic
1017939214 6:159036466-159036488 CACTTTTTTGTGAGGGGCAAAGG + Exonic
1018006322 6:159625623-159625645 CCATTGTTTCAGAGGGGCAATGG - Intergenic
1018131166 6:160733464-160733486 CTCCTTTTGAACAGGGGCACAGG + Intronic
1021684159 7:23165718-23165740 TTCGTTTTTCAAAGGGGCAGCGG - Exonic
1024553246 7:50581310-50581332 CTCCTGGTTGAGTGGGGCAACGG - Intergenic
1025600590 7:62992797-62992819 CACCTTTTTCTCAGGGACAAGGG - Intergenic
1027373594 7:77532599-77532621 CTCCCATTTCTGAGGGGAAAGGG + Intergenic
1029921218 7:104266420-104266442 CTCCTGTTTCAGAAGGCGAAAGG - Intergenic
1029974040 7:104815895-104815917 CTCATTCTTCAAAGGGGAAAGGG - Intronic
1030114640 7:106054001-106054023 CTCCTGTTTCAGGGGAGTAAGGG + Intergenic
1031062714 7:117070308-117070330 CTCCTTTTACAGATGAGAAATGG - Intronic
1031072895 7:117181864-117181886 CTCCTATTTCAGAAAGACAAAGG - Intronic
1031588997 7:123567142-123567164 ATCCTTTTGCAGAGGGGCAGTGG + Intronic
1034288882 7:149911626-149911648 CTCCTATTTAAGAGGAGCAGTGG + Intergenic
1036649334 8:10632326-10632348 CTCCATTTCCAGAGGAGAAAAGG - Intronic
1037862234 8:22413674-22413696 CTCCATTTTCTGATGGGAAACGG - Intronic
1040352982 8:46587203-46587225 CTCCTGGTTGAGCGGGGCAATGG - Intergenic
1044732022 8:95236672-95236694 CTGCTTATTAACAGGGGCAAAGG + Intergenic
1044925825 8:97208075-97208097 CTCCATTTCCAGTGGGGCCAAGG - Intergenic
1049398345 8:142412339-142412361 CTCATTTTCCAGATGGGAAAAGG - Intergenic
1051000868 9:12280286-12280308 CTCCTTTTGCACAAGGGTAATGG - Intergenic
1052338108 9:27339617-27339639 CTTATTTTACAGAGGGGTAATGG + Intronic
1053321003 9:37098748-37098770 CACCTCTTTCAGAGGGGCTGAGG + Intergenic
1054877422 9:70111452-70111474 CTCATTTTACAGATGAGCAATGG - Intronic
1054923022 9:70560636-70560658 CTCCTTCTTCAGAGGCACCAAGG - Intronic
1055164206 9:73171818-73171840 CTCTTTTTTCAAAAAGGCAATGG + Intergenic
1055612284 9:78035040-78035062 CTCCTAATTCAGAGGGGAAGGGG - Intergenic
1057115028 9:92512970-92512992 ATCCTTTGTCAGAGAGGCCATGG + Intronic
1057206131 9:93173691-93173713 CTCATTAGTCAAAGGGGCAATGG - Intergenic
1058718420 9:107742126-107742148 CTCCCTTTCCAGAGAGGCAGGGG + Intergenic
1058916991 9:109576954-109576976 CTCCCTTTGCAGAGTGGCATGGG + Intergenic
1059856187 9:118400236-118400258 TTCCTTTGTCAGAGAGACAATGG + Intergenic
1060398048 9:123329908-123329930 CTCCTTTTTCCCAGGAGCAAGGG - Intergenic
1060949221 9:127590460-127590482 ATCCTTCTTCATAGGGGAAAGGG + Intergenic
1188212958 X:27445272-27445294 GTCTTTTTTCAGAGGGGAGAGGG - Intergenic
1188343725 X:29038094-29038116 GTCCTTTCGCAGAGGGGCAATGG + Intronic
1188448071 X:30278061-30278083 CTCTATTTCCACAGGGGCAAGGG - Intergenic
1189003087 X:36965584-36965606 TTTCTTTTTCTGAGGGGCAGTGG - Intergenic
1189134475 X:38534313-38534335 CTCCTCTTTGAGAGGGGAGAGGG - Intronic
1189884831 X:45531698-45531720 TTGCTGTTTCAGAGTGGCAAAGG - Intergenic
1189978546 X:46486625-46486647 CTCCTGGTTCAGCAGGGCAATGG + Intronic
1190106940 X:47567580-47567602 CTCATTTCCCAGAGGGGAAAGGG - Intronic
1190131171 X:47750186-47750208 CTTCTTTCTCAGATGGGCAGTGG + Intergenic
1191587562 X:62845446-62845468 CTCCTCTTTCAGAGAGGTCATGG + Intergenic
1194788721 X:98118999-98119021 CTTCTTTTTGAGAAAGGCAAAGG + Intergenic
1195106121 X:101603040-101603062 CTCCTCTTTGAGAGTAGCAATGG - Intergenic
1195229247 X:102829609-102829631 CCCCTTTTACAGATGAGCAAGGG - Intergenic
1196925309 X:120628453-120628475 CTCATTTTACAGAGAGGAAATGG + Intronic
1197611265 X:128641325-128641347 CACCTTTCTCAGAGAGGCAGAGG + Intergenic
1197733726 X:129834130-129834152 CTCCCTTGCCAAAGGGGCAAGGG - Intronic
1197785633 X:130193998-130194020 CTCCTTTATCTGAGGTGCCAGGG - Intergenic