ID: 919494971

View in Genome Browser
Species Human (GRCh38)
Location 1:198253321-198253343
Sequence CTCCATACTACACTTGTTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 93
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 85}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919494971_919494973 8 Left 919494971 1:198253321-198253343 CCAGAAACAAGTGTAGTATGGAG 0: 1
1: 0
2: 0
3: 7
4: 85
Right 919494973 1:198253352-198253374 TTAGTTTTAACACTATTTCTAGG 0: 1
1: 0
2: 1
3: 59
4: 558

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919494971 Original CRISPR CTCCATACTACACTTGTTTC TGG (reversed) Intronic
905868582 1:41390277-41390299 CTCCATTCTGCACTTGTTACTGG + Intergenic
906273294 1:44498178-44498200 TTCCAATCTACACTTTTTTCTGG + Intronic
910507278 1:87963937-87963959 CACTATACTACACTTGAATCAGG + Intergenic
917352419 1:174091888-174091910 ATACATTCTACACTTGCTTCAGG - Intergenic
919494971 1:198253321-198253343 CTCCATACTACACTTGTTTCTGG - Intronic
919562641 1:199141006-199141028 CTCAATATTACAATTATTTCAGG - Intergenic
1062820619 10:532005-532027 CTGCATTCTAGACTTGGTTCTGG - Intronic
1066439557 10:35425166-35425188 CTCCAAACAAGACTGGTTTCAGG + Intronic
1073440947 10:103552385-103552407 CTCCATACCAACCTTGCTTCTGG + Intronic
1076314600 10:129531688-129531710 CTGCATACTACCTTTTTTTCCGG - Intronic
1080631053 11:34076370-34076392 CTCCATTCAAACCTTGTTTCAGG - Exonic
1083298572 11:61728321-61728343 CTCCACACCACCCTTCTTTCAGG + Intronic
1084146424 11:67267327-67267349 CTCCAGTCTACACTTGTGTGAGG + Intronic
1085879248 11:80446142-80446164 CTCCATACTACAAGTTTTTGAGG + Intergenic
1091049134 11:132352030-132352052 CTCCAGACGAGACTTGTTGCAGG - Intergenic
1092130956 12:6112930-6112952 CTACAGAATAGACTTGTTTCTGG + Intronic
1099916105 12:88895657-88895679 CTTCACACTACACTTGTTGGAGG - Intergenic
1101393003 12:104320104-104320126 CTCCTTGCTTGACTTGTTTCAGG - Intronic
1104497152 12:129251662-129251684 CTCCATGCTCCTCTTCTTTCGGG + Intronic
1104809485 12:131611804-131611826 ATCCATGGTGCACTTGTTTCCGG + Intergenic
1106041606 13:26098748-26098770 CTCCATATTACATTGGTTTTAGG + Intergenic
1106299467 13:28450964-28450986 CCCCATGCTACCCCTGTTTCTGG - Intronic
1108256853 13:48619306-48619328 CCCCATACTGCACATGTGTCGGG - Intergenic
1110043051 13:70789825-70789847 CTCCATACTATTTTTCTTTCTGG - Intergenic
1114259914 14:21029190-21029212 CTCCATGCTACACTTGAGCCTGG + Intronic
1118905573 14:70020943-70020965 CTCCCTCCAACACGTGTTTCTGG - Intronic
1128361912 15:66968121-66968143 CTCCATGCTATACCTGTTTCAGG - Intergenic
1134631355 16:15758341-15758363 CTCGGTAGTACACTTCTTTCGGG + Intronic
1139042900 16:63019637-63019659 CTCCATACTAGACATGTTCTAGG - Intergenic
1140669177 16:77258403-77258425 GTGCATCCTACACTTGTTCCTGG + Intronic
1141557411 16:84845296-84845318 CTCCTTACTACGCATGTTCCAGG - Intronic
1142567284 17:848918-848940 CTCCATACCACACATGTGCCTGG + Intronic
1145351194 17:22085215-22085237 CTTCTTACTATGCTTGTTTCTGG - Intergenic
1146071359 17:29685081-29685103 CTCCATATTATAATTGTTTGTGG - Intronic
1155849176 18:30749302-30749324 CTCCATAATCCAATTATTTCAGG - Intergenic
1158783437 18:60679624-60679646 CACCATTCTACTCTTGTTACCGG + Intergenic
926261166 2:11263505-11263527 CTACATAGTTCACTTGTATCGGG - Intronic
926869447 2:17396882-17396904 CTCCATATGACACTTCTTACTGG + Intergenic
926951083 2:18244144-18244166 CTCCATCCTTCACTTCTCTCAGG - Intronic
928942029 2:36735800-36735822 CTCCAAATTCCCCTTGTTTCAGG - Intronic
934608827 2:95719753-95719775 CTCTTCACTACAGTTGTTTCAGG - Intergenic
939884918 2:147671097-147671119 CTCCATTCTCCACTTCTTCCAGG - Intergenic
940994285 2:160130770-160130792 TTCCATATTACAGTTGATTCTGG + Intronic
942799142 2:179856737-179856759 CTCCTTACTACATTTTTCTCTGG - Intronic
947414976 2:229885559-229885581 CCCCTTACCACACTTGGTTCTGG - Intronic
948304305 2:236935377-236935399 CTCCATACTACATTAGTTGAGGG - Intergenic
948734452 2:239991865-239991887 CTCTATACTACACATGGTCCAGG - Intronic
1169557992 20:6769267-6769289 CTCCATTCTTCAAGTGTTTCCGG + Intronic
1170579095 20:17684519-17684541 CTCAACACAACATTTGTTTCGGG + Intergenic
1172254623 20:33506462-33506484 CTCCATAATACAGTTGTTAATGG - Intronic
1175483523 20:59328216-59328238 CTCTTTCCTCCACTTGTTTCTGG + Intergenic
1176649804 21:9535101-9535123 CTTCTTACTATGCTTGTTTCTGG + Intergenic
1178742222 21:35212514-35212536 CAACATACTAGACTTGCTTCTGG + Intronic
1182049645 22:27302958-27302980 CTCCATCCTCAACTTGTTCCAGG + Intergenic
1184010941 22:41747844-41747866 CACCAGACCACATTTGTTTCTGG + Intronic
949729958 3:7097426-7097448 CTCCATATAATACTTCTTTCAGG - Intronic
952602273 3:35099533-35099555 CTCAATACTATACTTCTTTATGG + Intergenic
954344967 3:49989227-49989249 CTCCATGCTACAGAAGTTTCTGG + Intronic
955238733 3:57162194-57162216 CTCCAGGCAACATTTGTTTCAGG - Intronic
955443061 3:58977892-58977914 CTCCTTCCCACACTTCTTTCAGG - Intronic
955556166 3:60139714-60139736 TTCCATACAACACGTATTTCTGG - Intronic
956757810 3:72406462-72406484 CTCCATATGACACTTGTGTCAGG - Intronic
960633891 3:119763829-119763851 CTCCCTACCACACTAGCTTCTGG - Intronic
965043793 3:163548505-163548527 TTCCACACTATACTTGTTTCAGG - Intergenic
967586938 3:191225467-191225489 GTCAATATGACACTTGTTTCAGG - Intronic
972708438 4:41569349-41569371 CTCCATACTACAGGTTTTACGGG - Intronic
977151293 4:93515773-93515795 TTCTACACTACACTTGTTTTTGG + Intronic
979033711 4:115684529-115684551 CTCCATATTACACTTTTTACAGG - Intergenic
985461356 4:190110064-190110086 ATCCATACTACATTTGATTAGGG + Intergenic
987544220 5:19291392-19291414 CTCCATGCTAAAAATGTTTCAGG + Intergenic
994564957 5:101432542-101432564 CTACTTAATACACTTGTTTAGGG - Intergenic
998093672 5:139384929-139384951 CTCCATCCTTCACCTGTTCCAGG - Intergenic
1007051346 6:38833735-38833757 CTCCCAACTAGACTTGGTTCAGG - Intronic
1010407076 6:75517741-75517763 CTCCATTCAACACTTGTATTTGG - Intergenic
1016680280 6:146820959-146820981 CTCAATACCACTCTTGTTTATGG + Intergenic
1022755818 7:33288052-33288074 CCCCTTACTGCACATGTTTCAGG - Intronic
1023981527 7:45073395-45073417 CTCCATCCCACACACGTTTCAGG - Intronic
1026373067 7:69721296-69721318 CTCCCTCCTTCACTTGATTCAGG + Intronic
1028641578 7:93047690-93047712 CTCTATACTCCACTTGGTGCAGG + Intergenic
1030840012 7:114339063-114339085 CTCAATAGTACACTTTTTTCTGG - Intronic
1032123493 7:129173791-129173813 CTCCTTCCTTCTCTTGTTTCTGG - Intergenic
1035794725 8:2344310-2344332 CTCCATCCTTTACTTCTTTCAGG - Intergenic
1038680703 8:29664376-29664398 CTCCATTCTACACTTGTCCCTGG + Intergenic
1043802290 8:84624721-84624743 CTGCCTACCACACTTGTTTTAGG + Intronic
1045873510 8:106951742-106951764 CTCCATACTTCATTTGTTAGTGG - Intergenic
1048704463 8:137136055-137136077 CCCCACATTAAACTTGTTTCTGG + Intergenic
1049242002 8:141542768-141542790 CTCCAGCCTCCACTTGTCTCGGG - Intergenic
1052943216 9:34146756-34146778 CTCAATATTACACTGGTTCCAGG + Intergenic
1056758728 9:89399537-89399559 TTCCAGACTCCACTGGTTTCAGG - Intronic
1058401827 9:104628033-104628055 GTTCATACTAAACCTGTTTCAGG - Intergenic
1203627546 Un_KI270750v1:38649-38671 CTTCTTACTATGCTTGTTTCTGG + Intergenic
1191665684 X:63700279-63700301 CTCTATACCACACAAGTTTCTGG + Intronic
1195745660 X:108115237-108115259 CTCTATACTAGATTTATTTCTGG - Intronic