ID: 919505137

View in Genome Browser
Species Human (GRCh38)
Location 1:198388843-198388865
Sequence CTATTGCAGCACATCTATTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919505135_919505137 22 Left 919505135 1:198388798-198388820 CCTTAAAAAGTGTGACATCTGCA No data
Right 919505137 1:198388843-198388865 CTATTGCAGCACATCTATTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919505137 Original CRISPR CTATTGCAGCACATCTATTC TGG Intergenic
No off target data available for this crispr