ID: 919507247

View in Genome Browser
Species Human (GRCh38)
Location 1:198414732-198414754
Sequence TTAAGGTTCTTCAAATTTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919507245_919507247 -2 Left 919507245 1:198414711-198414733 CCTGTATTTGAAGTTCAGTTTTT No data
Right 919507247 1:198414732-198414754 TTAAGGTTCTTCAAATTTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919507247 Original CRISPR TTAAGGTTCTTCAAATTTCA AGG Intergenic
No off target data available for this crispr