ID: 919510193

View in Genome Browser
Species Human (GRCh38)
Location 1:198453538-198453560
Sequence CATTAGAGAGAGAATGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919510193_919510199 30 Left 919510193 1:198453538-198453560 CCTTCCACATTCTCTCTCTAATG No data
Right 919510199 1:198453591-198453613 ATTTCTTTTAAACTTGTACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919510193 Original CRISPR CATTAGAGAGAGAATGTGGA AGG (reversed) Intergenic
No off target data available for this crispr