ID: 919513582

View in Genome Browser
Species Human (GRCh38)
Location 1:198494807-198494829
Sequence GCTGCTGTCCCGCCGGTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919513575_919513582 0 Left 919513575 1:198494784-198494806 CCTGTTCCTCTGTGCCAGACCAA No data
Right 919513582 1:198494807-198494829 GCTGCTGTCCCGCCGGTGGGTGG No data
919513573_919513582 10 Left 919513573 1:198494774-198494796 CCCTTCTCTGCCTGTTCCTCTGT No data
Right 919513582 1:198494807-198494829 GCTGCTGTCCCGCCGGTGGGTGG No data
919513574_919513582 9 Left 919513574 1:198494775-198494797 CCTTCTCTGCCTGTTCCTCTGTG No data
Right 919513582 1:198494807-198494829 GCTGCTGTCCCGCCGGTGGGTGG No data
919513576_919513582 -6 Left 919513576 1:198494790-198494812 CCTCTGTGCCAGACCAAGCTGCT No data
Right 919513582 1:198494807-198494829 GCTGCTGTCCCGCCGGTGGGTGG No data
919513571_919513582 26 Left 919513571 1:198494758-198494780 CCATGTCCTCGCTGGTCCCTTCT No data
Right 919513582 1:198494807-198494829 GCTGCTGTCCCGCCGGTGGGTGG No data
919513572_919513582 20 Left 919513572 1:198494764-198494786 CCTCGCTGGTCCCTTCTCTGCCT No data
Right 919513582 1:198494807-198494829 GCTGCTGTCCCGCCGGTGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919513582 Original CRISPR GCTGCTGTCCCGCCGGTGGG TGG Intergenic
No off target data available for this crispr