ID: 919516827

View in Genome Browser
Species Human (GRCh38)
Location 1:198535240-198535262
Sequence CCCTGTCTTGCATGTTTTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 152}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919516827 Original CRISPR CCCTGTCTTGCATGTTTTGT AGG (reversed) Intronic
902714393 1:18262416-18262438 CCCTGTCTTCTATAATTTGTGGG + Intronic
905298913 1:36972702-36972724 GCCTGTCTTGCATGGTTGTTGGG - Intronic
909101810 1:71357844-71357866 CCCTGACCTGCATGTTTTGCTGG - Intergenic
909141629 1:71874444-71874466 CCCTGTCTAGCAAGGTTTGTGGG + Intronic
912986728 1:114440846-114440868 CCATGTGTTGCATTCTTTGTTGG - Intronic
917088396 1:171327437-171327459 CCCTGTTTTGTTTGTTTGGTTGG + Intronic
919392718 1:197007188-197007210 CCCCATATTGCATGTTTTCTCGG - Intronic
919516827 1:198535240-198535262 CCCTGTCTTGCATGTTTTGTAGG - Intronic
920671473 1:208006735-208006757 CACTATCTTGCAGTTTTTGTGGG - Intergenic
921362443 1:214342499-214342521 CCTTTACTTGAATGTTTTGTGGG - Intergenic
1063083446 10:2790590-2790612 CTCTGGCTTGTCTGTTTTGTGGG - Intergenic
1063446024 10:6117897-6117919 GCCTGTCTTGCAGGTTGAGTAGG + Intergenic
1063627132 10:7700661-7700683 CCCTGACCTGCTTGTTTGGTGGG - Intergenic
1065291878 10:24238644-24238666 ACCTGTTTTGCAAGTTTTGCTGG + Intronic
1067688091 10:48479755-48479777 CCCTGTCTTGCAGGTGGTGCCGG - Exonic
1069937906 10:71931480-71931502 CCATGTCTAGCCAGTTTTGTGGG - Intergenic
1070391867 10:75977935-75977957 CCCTGTCTTGTAAGTTTGTTGGG + Intronic
1074661771 10:115667394-115667416 TCCTCTTTTCCATGTTTTGTTGG + Intronic
1077076456 11:704578-704600 CCCTGGTCTGCATGGTTTGTGGG - Intronic
1077220245 11:1412590-1412612 CCCTGTCTCGCATTTTCTGAGGG - Intronic
1078004982 11:7525860-7525882 CCCTGTCTTACAAGCTTTGGAGG + Intronic
1078688080 11:13551380-13551402 CCCTGCCTTGCCTTTTTCGTGGG - Intergenic
1078822621 11:14897327-14897349 CCCTGGCTTGAAGGTTTAGTGGG + Intergenic
1078863859 11:15278535-15278557 CCAGGTCTGGCATCTTTTGTGGG + Intergenic
1079909860 11:26296372-26296394 CCCTCTCTTCCATGCTTTGGGGG + Intergenic
1084041710 11:66546461-66546483 AGCTGTTTTGCATGTTTTCTGGG - Exonic
1084258119 11:67956101-67956123 CTGTGTCTTGCATGATTTGGAGG + Intergenic
1084814631 11:71639113-71639135 CTGTGTCTTGCATGATTTGGAGG - Intergenic
1089803732 11:121063460-121063482 CCCAGTCTTGGATGTTTGGGTGG + Intronic
1092595562 12:10000846-10000868 CCCTGTCTTTCACGTTCTTTTGG + Intronic
1098281604 12:68867947-68867969 GCCTGGCCTGGATGTTTTGTTGG - Intronic
1098807328 12:75036148-75036170 CACTGTCCTGCTTCTTTTGTTGG - Intergenic
1105629085 13:22143386-22143408 CTCTGGGTTGCTTGTTTTGTGGG - Intergenic
1107024139 13:35782463-35782485 CCCTGACTTACTTGCTTTGTAGG - Intronic
1107482864 13:40799358-40799380 CCATGTCTTGCCAGTTTTGTGGG - Intronic
1108270943 13:48759017-48759039 CCATCTCTTGCATCTTTTGGAGG - Intergenic
1110110592 13:71740410-71740432 CCCTGTGCTTCATGTTTAGTTGG - Intronic
1110426521 13:75373506-75373528 CCCGGACTTGCACTTTTTGTGGG + Intronic
1110723345 13:78790669-78790691 CCATCTCTTTCATGTTGTGTTGG + Intergenic
1111346991 13:86971364-86971386 CACTATCTGGTATGTTTTGTGGG + Intergenic
1111777643 13:92684701-92684723 CACTTTTCTGCATGTTTTGTGGG + Intronic
1111782501 13:92746087-92746109 CCCAATCTTACAGGTTTTGTTGG - Intronic
1112096206 13:96135154-96135176 CCCTGCCTTGCATGTTGAGTTGG + Intronic
1114009274 14:18349515-18349537 TTATGTCTTGCATGTTTTCTTGG - Intergenic
1114417792 14:22555945-22555967 CCCTGTCCTCCAGGCTTTGTTGG - Intergenic
1114810400 14:25892416-25892438 CCCTGTCTCCCATGTGGTGTGGG - Intergenic
1116704304 14:48277194-48277216 TCCTGTATTGCTTGTTTTGAAGG - Intergenic
1118068168 14:62215056-62215078 CCCTATCTTGCATGTACTGCTGG + Intergenic
1118334092 14:64836988-64837010 GCCTTTCTTGCATGATTTGAAGG - Intronic
1122351450 14:101095790-101095812 CCCTGTGAAGCATCTTTTGTGGG + Intergenic
1122854773 14:104554793-104554815 CCCTGCCTGGCTTGTTGTGTGGG - Intronic
1123392465 15:19890118-19890140 TTATGTCTTGCATGTTTTCTTGG - Intergenic
1124478607 15:30058638-30058660 CCTGGTTTTGCATGTGTTGTTGG + Intergenic
1125310735 15:38375737-38375759 CCCTGTCTTGCAATTTTAGTGGG - Intergenic
1128928399 15:71680230-71680252 TCCTGTCTTTCCTGTTTTGTTGG + Intronic
1130812557 15:87395049-87395071 CTCTGTCTTGTATGTTTAATAGG - Intergenic
1133369855 16:5239450-5239472 CTGTGTCTTGCATGATTTGGAGG - Intergenic
1133480633 16:6167066-6167088 CCCTGCCTTGCCTGTGTTTTGGG + Intronic
1133517400 16:6522807-6522829 CCTTGACCTGCAGGTTTTGTGGG + Intronic
1134493081 16:14710705-14710727 CCCTGTTTTGCTTGTTTCTTAGG + Intronic
1134498462 16:14749829-14749851 CCCTGTTTTGCTTGTTTCTTAGG + Intronic
1135844006 16:25901848-25901870 CCCTGCCTTGCCAGTTTTTTGGG - Intronic
1137864658 16:51880765-51880787 CCATTTCTTGCATTTTATGTTGG + Intergenic
1140554606 16:75907506-75907528 CCCTTTCTGTCTTGTTTTGTTGG - Intergenic
1148814090 17:50314229-50314251 CCCTGTCCAGCATGTCTTGGGGG + Intergenic
1154528201 18:15314375-15314397 TTATGTCTTGCATGTTTTCTTGG + Intergenic
1159084606 18:63774523-63774545 CCCTGTGTGGCATGTTCTGATGG + Intronic
1166732693 19:45067846-45067868 CCCTGTCTTACAGGTTCTGTGGG + Intronic
1168605178 19:57753081-57753103 TCCTGTAGTGCATGTATTGTTGG - Intronic
925404034 2:3594488-3594510 CCGAATCTTGCATGTTTTGGGGG - Intergenic
926026527 2:9550085-9550107 CCCTGTCCTGTGTGTTTTGGGGG - Intronic
928664955 2:33540981-33541003 CCCTGTGTTGCAAGTATTTTGGG - Intronic
931401461 2:61935214-61935236 TGCTGTCTTGCATATCTTGTCGG - Intronic
933861511 2:86474239-86474261 CCCTGTCTAGCTTGTCTTTTGGG + Intronic
938527304 2:132145838-132145860 TTATGTCTTGCATGTTTTCTTGG + Intergenic
939111707 2:138016382-138016404 CACTTTTTTGCATGTATTGTTGG + Intergenic
940382052 2:153026271-153026293 CTCTGTGTTGCATATTCTGTAGG + Intergenic
942108509 2:172657095-172657117 TCCTGTCTTGCAAATTTTCTGGG + Intergenic
942325616 2:174774542-174774564 CCCTGTCTTTCTTGATTTCTTGG - Intergenic
945324580 2:208467719-208467741 CCCTGTCTCTCAGTTTTTGTAGG - Intronic
946244348 2:218378128-218378150 TCCTTTTTTGCATCTTTTGTGGG - Intergenic
947330405 2:229023553-229023575 ACCTGTCTTGCTTGTTTAATGGG + Intronic
947387281 2:229604106-229604128 CCCTGTTTGGCATGTTTCATTGG - Intronic
948240279 2:236426314-236426336 CAATGTTTTGCATGTTTTGTAGG + Intronic
1169559126 20:6780498-6780520 CCAGGTTTTGCTTGTTTTGTAGG - Intergenic
1174537594 20:51264111-51264133 CCATGTTTTGCATGTTTCGTGGG - Intergenic
1174952103 20:55053432-55053454 TCTTATCTTGCATGGTTTGTTGG + Intergenic
1175189344 20:57200541-57200563 CTCTGTCTTGCCTGTTCTGCTGG - Intronic
1176769218 21:13054165-13054187 TTATGTCTTGCATGTTTTCTTGG - Intergenic
1178289469 21:31354644-31354666 ACCTGTCATGCATGTTTTACCGG - Intronic
1180433775 22:15280325-15280347 TTATGTCTTGCATGTTTTCTTGG - Intergenic
1180516330 22:16148234-16148256 TTATGTCTTGCATGTTTTCTTGG - Intergenic
1181046728 22:20218216-20218238 CCCAGTGTTGCATGTCTGGTGGG - Intergenic
1182144376 22:27988234-27988256 CACTGTCTAACCTGTTTTGTGGG - Intronic
1182418249 22:30235321-30235343 CCCTGTCTTCCAGCTTTTGGTGG + Intergenic
950292422 3:11796214-11796236 GCCTGGCTTCCATCTTTTGTAGG + Intronic
950735535 3:15004883-15004905 CCCTTTCTTGCTTGCTTTCTTGG + Intronic
952008673 3:28874040-28874062 CTCTCTCTAGCATTTTTTGTAGG + Intergenic
955056904 3:55462925-55462947 CCCTCTCTGGCAGGTTTTGTGGG - Intergenic
955414646 3:58680713-58680735 GCCTGTCTTGCTTTTTTTTTTGG + Intergenic
955488849 3:59462459-59462481 CCTTGTCTGGCATGTTTAGATGG - Intergenic
956351379 3:68340762-68340784 CCCTGTCTTACATGTTGGGATGG + Intronic
956787903 3:72657748-72657770 CCTTGTCTTGCTTATTTTATAGG - Intergenic
957073065 3:75580614-75580636 CTGTGTCTTGCATGGTTTGGAGG + Intergenic
957571088 3:81948260-81948282 CCCTTTCCTGCATCTGTTGTTGG - Intergenic
961489372 3:127242680-127242702 CCCTGTCTAGACAGTTTTGTGGG + Intergenic
961675776 3:128565455-128565477 TCCTGGCTTGCATTTTTGGTTGG - Intergenic
969016666 4:4107911-4107933 CTGTGTCTTGCATGATTTGGAGG + Intergenic
969737291 4:9000404-9000426 CTGTGTCTTGCATGATTTGGAGG - Intergenic
969796494 4:9531992-9532014 CTGTGTCTTGCATGATTTGGAGG - Intergenic
970439340 4:16066792-16066814 CCCTTTCCTGCATGTATTGAAGG + Intronic
971450994 4:26801705-26801727 CCCTGTCTTGTTTGTTTTGAAGG - Intergenic
972891003 4:43555816-43555838 TCATTTCTTGCTTGTTTTGTGGG + Intergenic
975496952 4:75045937-75045959 TCCTGACTGGCATGTTCTGTTGG - Intronic
975809099 4:78147061-78147083 CCCTTTCCTGGATGTTTTATAGG + Intronic
977985868 4:103381967-103381989 CTCTGTTTAGCATGTCTTGTAGG - Intergenic
981077542 4:140606311-140606333 TCCTGGCTTGTGTGTTTTGTTGG - Intergenic
981129104 4:141138600-141138622 CCCAGTCTTCCATGTTTGTTTGG + Intronic
983383522 4:167027417-167027439 CCTTGTCTTGCATTTTGTTTGGG + Intronic
985155548 4:186983709-186983731 ACCTTTGATGCATGTTTTGTAGG + Intergenic
985880041 5:2632436-2632458 ACCTGAATTGCATGCTTTGTAGG - Intergenic
989198438 5:38738610-38738632 CCCTGTCTTCCATCTGTTGCTGG - Intergenic
991697627 5:69287945-69287967 CTCTGAATTGCATTTTTTGTGGG + Intronic
993804628 5:92389247-92389269 CCCTGTCTTCTATTTATTGTTGG - Intergenic
994040364 5:95252323-95252345 CCCTATCTTCCAGTTTTTGTGGG - Intronic
996750453 5:126883347-126883369 CTCTGTACTGCATGTTTTGATGG - Intronic
996841451 5:127851426-127851448 CCATGTCTTTCTTGTTTTTTTGG + Intergenic
1000629083 5:163571691-163571713 ACCTGTGTTGCCTGTTTTTTAGG + Intergenic
1000805474 5:165785415-165785437 CCCTGTATTGAATGGTTTGGAGG - Intergenic
1002128137 5:177062073-177062095 CACTATCTTACATGTTTTGCAGG - Exonic
1002989400 6:2224049-2224071 CCTTGTCTTACTTGCTTTGTTGG - Intronic
1006721354 6:36153890-36153912 CCTTTTGTTGCATGTTTTCTAGG + Intergenic
1008819764 6:55617207-55617229 TCCTGTCTTGCTTGTTTTCTTGG + Intergenic
1010001254 6:70952169-70952191 CCCTTGCTTGAATCTTTTGTTGG - Intronic
1013890096 6:115016455-115016477 CTATGACATGCATGTTTTGTTGG - Intergenic
1015327981 6:131946502-131946524 CCCTGGCTTGTAAGCTTTGTTGG + Intergenic
1017756689 6:157535111-157535133 CTCTGTCTTGCATGCTTGGAGGG + Intronic
1018558481 6:165074817-165074839 CCCTGTCTTTCTTCTTTGGTTGG + Intergenic
1019217355 6:170452404-170452426 CCCTGTCCTGCAGGGTTTCTGGG - Intergenic
1021382495 7:19984413-19984435 CACTGCCTTTCATGTTTAGTTGG + Intergenic
1021927414 7:25546595-25546617 CCCTTTCATGAATATTTTGTGGG - Intergenic
1022711109 7:32851237-32851259 CCATATCTTGAATGTTTGGTAGG - Intergenic
1027521158 7:79209965-79209987 CATTGTCTTGTAAGTTTTGTGGG + Intronic
1029075141 7:97928711-97928733 CTGTGTCTTGCATGATTTGGAGG + Intergenic
1029260485 7:99299317-99299339 CCCTGTCTTGCACCTTTTTAAGG + Intergenic
1033536334 7:142315246-142315268 CCCTGTCTCCCAGTTTTTGTGGG - Intergenic
1033957960 7:146875575-146875597 CCCTGTCTTCCAGCTTCTGTGGG + Intronic
1035282694 7:157787551-157787573 CCTTGTCCTTCATGTCTTGTAGG + Intronic
1039008571 8:33068422-33068444 CCCTCTCTTGCTTGTAATGTAGG - Intergenic
1039117817 8:34112238-34112260 CCCTGCCTTCCCTGTGTTGTTGG - Intergenic
1042701444 8:71619245-71619267 CCCTGTCTAGCATGTGGTCTGGG + Intergenic
1044946316 8:97393175-97393197 CCCTGTCTTGGCTGTTCTTTAGG - Intergenic
1051173283 9:14341102-14341124 CCCTGTCTTGCATTCTTCTTGGG - Intronic
1053117046 9:35514119-35514141 CCCTGTCTACCATTATTTGTTGG - Intronic
1053705991 9:40753127-40753149 TTATGTCTTGCATGTTTTCTTGG + Intergenic
1054416069 9:64876731-64876753 TTATGTCTTGCATGTTTTCTTGG + Intergenic
1059640078 9:116207870-116207892 CACTGTCTTGCGTGTGATGTTGG - Intronic
1060729154 9:126026219-126026241 TCCTTTCTTGCAGGTGTTGTGGG + Intergenic
1061996136 9:134187029-134187051 CCCTGGCTTGCCTGCTTTTTTGG - Intergenic
1062236607 9:135513201-135513223 CCCTGGCTTGGCTGTTTTATGGG - Intergenic
1195953920 X:110308445-110308467 TCCTGTCTGGCAATTTTTGTGGG - Intronic
1196001532 X:110792377-110792399 TCCTGTCTTGCAAGGCTTGTGGG + Intronic
1198452986 X:136786395-136786417 CCTTCTGTTGCTTGTTTTGTTGG - Intergenic
1199282648 X:146020796-146020818 CCCTGTCTTGCAGAATTTGCAGG - Intergenic
1199558242 X:149132841-149132863 CCATGTCTTGCCTTTTTTGGTGG - Intergenic