ID: 919524821

View in Genome Browser
Species Human (GRCh38)
Location 1:198634288-198634310
Sequence CTGTCCATACAAATCAAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919524821_919524828 30 Left 919524821 1:198634288-198634310 CCCAGCTTGATTTGTATGGACAG No data
Right 919524828 1:198634341-198634363 ACTGAAGGAAGATAAGATGGAGG No data
919524821_919524826 15 Left 919524821 1:198634288-198634310 CCCAGCTTGATTTGTATGGACAG No data
Right 919524826 1:198634326-198634348 CTCTTTGGAGGAAATACTGAAGG No data
919524821_919524824 0 Left 919524821 1:198634288-198634310 CCCAGCTTGATTTGTATGGACAG No data
Right 919524824 1:198634311-198634333 AAATCGGTTTGATTTCTCTTTGG No data
919524821_919524825 3 Left 919524821 1:198634288-198634310 CCCAGCTTGATTTGTATGGACAG No data
Right 919524825 1:198634314-198634336 TCGGTTTGATTTCTCTTTGGAGG No data
919524821_919524827 27 Left 919524821 1:198634288-198634310 CCCAGCTTGATTTGTATGGACAG No data
Right 919524827 1:198634338-198634360 AATACTGAAGGAAGATAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919524821 Original CRISPR CTGTCCATACAAATCAAGCT GGG (reversed) Intergenic
No off target data available for this crispr