ID: 919527833

View in Genome Browser
Species Human (GRCh38)
Location 1:198677048-198677070
Sequence TTGAAAATTACTACCATTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 260
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 239}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919527830_919527833 29 Left 919527830 1:198676996-198677018 CCTTATAACCTCTTAAATTAGTT 0: 1
1: 0
2: 4
3: 17
4: 294
Right 919527833 1:198677048-198677070 TTGAAAATTACTACCATTGATGG 0: 1
1: 0
2: 1
3: 19
4: 239
919527831_919527833 21 Left 919527831 1:198677004-198677026 CCTCTTAAATTAGTTTTATCTAT 0: 1
1: 0
2: 6
3: 47
4: 569
Right 919527833 1:198677048-198677070 TTGAAAATTACTACCATTGATGG 0: 1
1: 0
2: 1
3: 19
4: 239

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919527833 Original CRISPR TTGAAAATTACTACCATTGA TGG Intronic
904847933 1:33434771-33434793 ATGAGAATTACTAACATTTATGG + Intergenic
906472532 1:46143141-46143163 GAGAAAAATACTACCAATGAAGG - Intronic
908189219 1:61684208-61684230 TTGAAGATTGCTACCTTAGAGGG - Intronic
909345169 1:74576664-74576686 ATGACAATTACTAAAATTGAAGG + Intronic
910064157 1:83132962-83132984 TTGAAACATATAACCATTGAGGG - Intergenic
910537043 1:88310225-88310247 CTGAAAATAACTATTATTGATGG - Intergenic
911088609 1:94000349-94000371 TTCAAGATTACTGCCATTGTTGG + Intronic
911968420 1:104398001-104398023 ATGAAGATTATTACAATTGAAGG - Intergenic
912000531 1:104828804-104828826 ATGAAAATTAATAATATTGATGG - Intergenic
912147776 1:106815387-106815409 TTGAAAATTAATATCTTTTAAGG - Intergenic
913024784 1:114826673-114826695 TTGGAAAATATTACCATTGAAGG + Intergenic
913476571 1:119244121-119244143 TTGGCAATTACTACAAATGAGGG + Intergenic
917665875 1:177224940-177224962 TTGAAAATTATTGCCAAGGAGGG - Intronic
917880148 1:179327158-179327180 TTGACATTTACTAACATGGAAGG + Intronic
918005592 1:180539508-180539530 TTAAATATTTCTACCACTGAAGG + Intergenic
918865181 1:189887477-189887499 TTGAAGATTACAATTATTGATGG + Intergenic
919345725 1:196375340-196375362 TGTAAAATTGCCACCATTGATGG - Intronic
919527833 1:198677048-198677070 TTGAAAATTACTACCATTGATGG + Intronic
920776478 1:208943070-208943092 TAGAAAATTACTACCTTGGTAGG - Intergenic
923381349 1:233421661-233421683 TTGAAAAATAATAACATTGGAGG - Intergenic
1063423382 10:5932221-5932243 TTTAAAATAACTACCAATGGTGG - Intronic
1064555585 10:16544018-16544040 TTAAAAATTACTACCAGGGTTGG - Intergenic
1064667250 10:17667609-17667631 TAGAATATTAGCACCATTGACGG - Intronic
1066187348 10:33023187-33023209 TTGATAATTTTTAGCATTGAAGG + Intergenic
1067835343 10:49634957-49634979 TTGGAAAATGCTACCATTGGTGG - Intronic
1068187696 10:53607678-53607700 TTGATAATTCCTAACTTTGAAGG - Intergenic
1074926497 10:118078064-118078086 TTCAAAAATACTTCCATTTAAGG + Intergenic
1079756438 11:24270364-24270386 ATCACAATTACTACAATTGATGG + Intergenic
1079797369 11:24822705-24822727 TTGAGAAATACTACCCTAGATGG - Intronic
1080722893 11:34867101-34867123 TTGAAAATTACCATCATTGAGGG - Intronic
1081019625 11:37929319-37929341 TTGCAAATTACTTCAATTTAGGG - Intergenic
1081074159 11:38648310-38648332 TTGAAAATAAATAGCATAGAGGG + Intergenic
1081941853 11:46949972-46949994 CTGAAAATAACTATTATTGAAGG + Intronic
1086207202 11:84273661-84273683 GTGAAAAGTAGTAACATTGAAGG + Intronic
1086281215 11:85191747-85191769 CAGAAATATACTACCATTGATGG + Intronic
1086333357 11:85775944-85775966 TTGAAATTTAATCCCAATGATGG + Intronic
1086596091 11:88572757-88572779 ATAAAAAATACAACCATTGATGG - Intronic
1087416201 11:97858999-97859021 TTGAAAATAATTACCATTTTTGG - Intergenic
1088140970 11:106615779-106615801 TTAAAAATCACTAACATTTATGG - Intergenic
1088537237 11:110874680-110874702 TTAAAAATAACTGCCATTGGTGG - Intergenic
1090098172 11:123764703-123764725 TTTAACATTACTAGCAGTGAAGG + Intergenic
1093084538 12:14852122-14852144 TTTAAAATGACTATGATTGATGG + Intronic
1093241825 12:16686226-16686248 TTGAACATTTATAACATTGAGGG + Intergenic
1093248379 12:16768666-16768688 TTGAGAATTTTTACCTTTGATGG - Intergenic
1093729518 12:22551361-22551383 TTACAAATTACTGCAATTGATGG + Intergenic
1093798689 12:23345500-23345522 TTGAGAATTATAATCATTGAAGG + Intergenic
1098315152 12:69185033-69185055 TTGAAAATTACCCCCAAAGAGGG - Intergenic
1098962913 12:76757440-76757462 TTTAAAATTACTAGCATTACAGG + Intergenic
1099237747 12:80102358-80102380 ATGAAAAGGTCTACCATTGAGGG - Intergenic
1101311916 12:103588462-103588484 ATGATAATTACTACCATTTGTGG - Intronic
1103104554 12:118211794-118211816 ATAAAAATTACTACCATAAAAGG - Intronic
1104680519 12:130748105-130748127 TGACAAATTACTACCATCGAGGG - Intergenic
1105268755 13:18849372-18849394 TTGAAAAGTCTTACTATTGATGG + Intergenic
1105409916 13:20162420-20162442 TTGAAAAATGCTACCTTTGAAGG + Intergenic
1106177750 13:27345732-27345754 ATGAAAATGACCACCATCGAGGG - Intergenic
1107608550 13:42088246-42088268 TTTAAAATTTCTTCCAGTGAAGG - Intronic
1108080244 13:46727732-46727754 TTGAAAGTTGTTACCATTGAAGG + Intronic
1108285472 13:48903522-48903544 TTGAAAATGACTACCTCTGAAGG + Intergenic
1108329422 13:49370402-49370424 GTGAAAAATACGACCACTGATGG + Intronic
1108605352 13:52031920-52031942 TTGAAAATTACGACAGTTAAGGG + Exonic
1109507294 13:63320612-63320634 TTAATAATTACTACAAATGAAGG + Intergenic
1109756883 13:66773201-66773223 TTGAACATTTCTTCCGTTGAAGG - Intronic
1109961819 13:69640937-69640959 GTGAAAATTACTGCCAAAGAAGG + Intergenic
1110190572 13:72725494-72725516 TTCACAAATGCTACCATTGAGGG + Intronic
1111743927 13:92241553-92241575 TTGAAAATCATTACCTTAGATGG + Intronic
1116595837 14:46843941-46843963 TTAAAAATGACTGCAATTGAAGG - Intronic
1116710610 14:48363442-48363464 TTGACACTGACTACCATTTAAGG - Intergenic
1117148782 14:52863573-52863595 TTGGAAATTAATACCATAAAAGG - Intronic
1117291289 14:54336192-54336214 TTGCAAAATGCTACCACTGAGGG + Intergenic
1117793761 14:59369296-59369318 TTTAAAATTATTTTCATTGATGG + Exonic
1120414850 14:84206518-84206540 TAGAAAATAACTAGCATTGTGGG + Intergenic
1120837088 14:89050007-89050029 AGGAAAATTTCTAGCATTGAAGG + Intergenic
1121032769 14:90673579-90673601 ATGATAATTACTAACATTTATGG + Intronic
1202830553 14_GL000009v2_random:24580-24602 TTGAAAAGTCTTACTATTGATGG - Intergenic
1124083480 15:26523001-26523023 TTGAATATTAGCACAATTGATGG - Intergenic
1125775124 15:42205805-42205827 TTGATGATTACTACTCTTGAAGG - Intronic
1126394525 15:48199917-48199939 TTGAATATTTCTACCACTTAAGG + Intronic
1129025435 15:72568837-72568859 TTTTAAATTGCTATCATTGATGG + Intronic
1131759956 15:95611833-95611855 TAGATTTTTACTACCATTGAAGG - Intergenic
1134404456 16:13943651-13943673 TTGAAATTAATTAACATTGATGG + Intronic
1140198205 16:72873138-72873160 GTGAAAAATACGCCCATTGAAGG - Intronic
1140344303 16:74197462-74197484 TTGAAAATTATTCCCATGGGAGG - Intergenic
1141516978 16:84551874-84551896 TTGAGAATTTCTCCCAGTGAGGG - Intronic
1146780068 17:35662050-35662072 TTGAGAGTCACTACTATTGATGG - Intronic
1147400011 17:40175091-40175113 TTGAAAATCACTGCCCTAGACGG - Intergenic
1149602677 17:57903388-57903410 TTGAAAATTATTAACATGCAGGG + Intronic
1154125184 18:11686281-11686303 TTGAAAATTACTATAACTGAAGG - Intergenic
1154419267 18:14210625-14210647 TTGAAAAGTCTTACTATTGATGG - Intergenic
1156147536 18:34203535-34203557 TTGAAAATTGTTACCATTGGTGG + Intronic
1156622229 18:38866150-38866172 TTGCAAATTATTGCCATTGGAGG + Intergenic
1156671271 18:39472960-39472982 TTGAGAATGACTACTATTGCTGG + Intergenic
1157637491 18:49173552-49173574 TTGAAAAATAATGCCATTTACGG - Intronic
1157759451 18:50249832-50249854 TTGCAAGATATTACCATTGAGGG + Intronic
1158151422 18:54376976-54376998 ATGGAAATTACTAACATTGGAGG + Intronic
1158805018 18:60961153-60961175 TTTAGAATTTCTACTATTGAAGG + Intergenic
1158980749 18:62758805-62758827 TTGAAAATTGCTTCCTTTTAAGG + Intronic
1159069417 18:63606428-63606450 TTGAAAACTATTACCAAAGAAGG - Intergenic
1159835605 18:73331284-73331306 ATGAAAATTACTACAATTCAAGG + Intergenic
1160253241 18:77222575-77222597 TTGAGAAGTACTACCACTAAAGG - Intergenic
1162437979 19:10674237-10674259 TTAAGAATTACTACTATGGACGG - Intronic
1202642141 1_KI270706v1_random:103199-103221 TTGAAAAGTCTTACTATTGATGG + Intergenic
925287523 2:2725674-2725696 TTGAACATTGCTGCCATTCAAGG - Intergenic
926759381 2:16264031-16264053 TTAAAAATTACTATTTTTGATGG + Intergenic
929342972 2:40845370-40845392 TTGAAAGTTGTTACCATTGAGGG - Intergenic
930325872 2:49916526-49916548 TTTAAAATTAATACTATTGTAGG - Intergenic
930566134 2:53022880-53022902 TTGAAAATTAAAACCATAAAGGG - Intergenic
934497978 2:94826713-94826735 TTGAAAAGTCTTACTATTGATGG + Intergenic
936032867 2:109086300-109086322 TTGTTCATTCCTACCATTGAAGG + Intergenic
939941099 2:148352386-148352408 TTGACAGATACTACCATTGGGGG - Intronic
940334747 2:152514095-152514117 TTGAAAATTACAACAGCTGAGGG - Intronic
940386881 2:153084508-153084530 GTGGAAATTACTACAATTTAAGG - Intergenic
941090608 2:161170578-161170600 TTTAAAATTACTGCCATAGGGGG - Intronic
941882255 2:170493025-170493047 TTGAACAGTATTACCTTTGAGGG - Intronic
943142897 2:184005036-184005058 TTGTAAATTACTGGCATTGCTGG - Intergenic
945151190 2:206793694-206793716 CTGAAAATTACTACCCTAAAAGG - Intergenic
946451315 2:219782227-219782249 CTGAAATCTACTACCATTCATGG - Intergenic
1170125501 20:12959053-12959075 ATTAAAATTATTACCATTTATGG + Intergenic
1170197801 20:13707986-13708008 TTTCAAAATACTACCATTGAGGG - Intergenic
1170801294 20:19592664-19592686 ATGAAAATTACTCACTTTGAAGG - Intronic
1176609738 21:8869418-8869440 TTGAAAAGTCTTACTATTGATGG - Intergenic
1176854038 21:13948668-13948690 TTGAAAAGTCTTACTATTGATGG + Intergenic
1177328529 21:19626627-19626649 TTGAATTTTACTTCCATAGACGG + Intergenic
1177846371 21:26292411-26292433 GTGAAAATTACTCCACTTGAAGG + Intergenic
1179275298 21:39886264-39886286 CTGAAAATTAATATCATAGAAGG - Intronic
1180359796 22:11878659-11878681 TTGAAAAGTCTTACTATTGATGG - Intergenic
1183243600 22:36676379-36676401 ATGCAAATGACTACCATCGATGG + Intronic
949546627 3:5078503-5078525 TTAAAAATAACTACAATAGAAGG - Intergenic
950825754 3:15818946-15818968 TTGAAAATCAATAAAATTGAGGG + Intronic
955266904 3:57453049-57453071 TTTAAAATTATTTCCATTTAAGG - Intronic
957560875 3:81819036-81819058 TGGAAAATTAATGTCATTGAAGG - Intergenic
962107425 3:132406025-132406047 TTGAATATTTCTTCCACTGAAGG - Intergenic
962338941 3:134564577-134564599 ATGAAAATCACTACCATTCAAGG + Exonic
963539627 3:146568287-146568309 ATGAAAATTATTACAATTCAAGG + Intergenic
963562366 3:146881982-146882004 TTGAAAAAGAATACAATTGAGGG - Intergenic
963625255 3:147663803-147663825 TTAAAAATTACTACCATCAAAGG + Intergenic
965840116 3:172895141-172895163 TTGCAAGATATTACCATTGACGG - Intronic
966650382 3:182294422-182294444 ATGAAGATTCCTAACATTGAAGG - Intergenic
967703922 3:192627748-192627770 TTGCAAAATATTACCATTGGGGG - Intronic
1202736420 3_GL000221v1_random:4195-4217 TTGAAAAGTCTTACTATTGATGG - Intergenic
969903368 4:10370611-10370633 TTGAAATATATTCCCATTGAAGG - Intergenic
970335549 4:15036999-15037021 TTGAAAAGGACTATCATTTAGGG + Intronic
970945719 4:21689169-21689191 TTGAAAACTAATACAATTAAAGG + Intronic
971681942 4:29711270-29711292 TTGAAAAGTACTACTATGTATGG + Intergenic
972849143 4:43026646-43026668 TTGAAAACTACTATCATAGAGGG + Intronic
975195069 4:71514659-71514681 TTCAAAATCACTACTAATGATGG + Intronic
976118626 4:81755779-81755801 TTGAAATTTGGTAGCATTGAGGG + Intronic
976717832 4:88142064-88142086 ATGAAAATTATTACCATGAAAGG + Intronic
977741834 4:100493568-100493590 TTTAAAATTAGTAGCATAGATGG - Intronic
980446749 4:132920195-132920217 TTGAAAACTACTGCCACTGGTGG - Intergenic
980537838 4:134152399-134152421 TTGAAAATTAATAAAATTTAAGG + Intergenic
980710392 4:136558689-136558711 TATAACATTACTACCAGTGATGG + Intergenic
981364443 4:143885671-143885693 TTGGGAATTTCTAACATTGAAGG + Intronic
981374936 4:144003955-144003977 TTGGGAATTTCTAACATTGAAGG + Intronic
981385559 4:144126143-144126165 TTGGGAATTTCTAACATTGAAGG + Intronic
981864942 4:149406313-149406335 TTGAATATTACCACCAGTCAGGG + Intergenic
983041118 4:162928532-162928554 TTGAAAAATAATTACATTGATGG + Intergenic
983199654 4:164847346-164847368 TTTAAAATTATTACCAGTAATGG + Intergenic
984209511 4:176828637-176828659 TTGTAAATTAGTACCTTTTATGG + Intergenic
1202769512 4_GL000008v2_random:189071-189093 TTGAAAAGTCTTACTATTGATGG + Intergenic
986412678 5:7496713-7496735 TTGAAAACCACTAGCATTAATGG + Intronic
988120935 5:26961407-26961429 TTAAAAATTATAACCATTGAGGG - Intronic
988480116 5:31622848-31622870 ATGAAAATTGTTACCATTTAGGG - Intergenic
989100749 5:37820801-37820823 TTGAAAATTCCTTCCTTTGATGG + Intronic
989305336 5:39948628-39948650 TTGAAAAATACCTCCATTGGGGG - Intergenic
989546353 5:42678695-42678717 TTGAAAATTAATAAAATTGTTGG - Intronic
989699818 5:44249689-44249711 ATAAAAATTAATTCCATTGAAGG - Intergenic
989761020 5:45016653-45016675 TTGAAAATTACTGCAGTTGTGGG + Intergenic
990132833 5:52609016-52609038 ATGAGAATTACTACAATTCAAGG - Intergenic
990267459 5:54092815-54092837 TTGAAAATTAGTATCAGTGTAGG - Intronic
993206082 5:84880213-84880235 TTGTCAATTACTACCAATAAGGG + Intergenic
993336594 5:86666973-86666995 TTGAAAATTATTTTCCTTGATGG + Intergenic
994786045 5:104164699-104164721 TTCAAAATTACTTCCATCCAGGG - Intergenic
998672536 5:144369775-144369797 TGTAAAATGAGTACCATTGAAGG + Intronic
998997916 5:147886306-147886328 TTGCAAGATACTACCATTGGAGG + Intronic
1000057165 5:157617677-157617699 TTGAAAAACACTGCCATAGATGG + Intergenic
1000817239 5:165938413-165938435 TTTAAAATTAATACCATTTTTGG - Intergenic
1000844479 5:166262307-166262329 TTGAAAATAAATACCATAAATGG + Intergenic
1008258192 6:49330741-49330763 TTAATATTTACTACCCTTGATGG + Intergenic
1008389789 6:50936738-50936760 TTGAAAATTATTAGAAATGAAGG + Intergenic
1008762379 6:54867980-54868002 TTGAAAATTCCAGCCAATGAAGG - Intronic
1008900903 6:56614731-56614753 TTTAAAATTTGTAACATTGATGG - Intronic
1009577303 6:65482110-65482132 ATGATAATTATTAGCATTGATGG - Intronic
1012556060 6:100513095-100513117 TTGAAAAATGCTACCTTTGGAGG - Intronic
1012647682 6:101708555-101708577 TTTAAAATTACTACAATATATGG + Intronic
1012761483 6:103308694-103308716 TAGAAAAATTATACCATTGAAGG + Intergenic
1012864233 6:104598188-104598210 TTGAAAATTACTACTCTTGCAGG + Intergenic
1013868864 6:114732069-114732091 TTGAAAATTAGTACACTTTAGGG - Intergenic
1014011889 6:116485425-116485447 TTGAGAAATACTACCATTCAAGG - Intergenic
1014020649 6:116584836-116584858 TTTAAAATTACTAGCATTACAGG + Exonic
1016188669 6:141232106-141232128 TTTCAAATTGCTACCAATGAGGG + Intergenic
1016288131 6:142496521-142496543 TTACAAATTGCTACCTTTGAAGG + Intergenic
1016603164 6:145887258-145887280 TAGAAATTTTCTTCCATTGATGG - Intronic
1017446957 6:154515916-154515938 ATGAAAATTAATACCAATCAGGG + Intergenic
1018354604 6:162999945-162999967 TGTAAAATTATTACCATTGTAGG - Intronic
1020494002 7:8823794-8823816 TTGAATATTACTCACATTGAAGG + Intergenic
1020945026 7:14593615-14593637 TGGAAAATTATAACCCTTGAAGG + Intronic
1021390169 7:20083165-20083187 TTGATAAATATTAACATTGATGG - Intergenic
1021516503 7:21493744-21493766 TTGACAAATTCTACCATTTAAGG + Intronic
1021864613 7:24942659-24942681 TTGAATATTCCTAGCCTTGAAGG - Intronic
1023569296 7:41555769-41555791 TTGAAAAAGACAACCATTAATGG - Intergenic
1025807965 7:64853561-64853583 ATGAAACTTACCACCTTTGAAGG + Intergenic
1026247941 7:68639055-68639077 TTGAAAATTTCTTCCATTTTTGG - Intergenic
1028164973 7:87528160-87528182 GTGAAGATTATTACCATTCAAGG + Intronic
1028618997 7:92802961-92802983 TTGAGAACTACTACTATAGAGGG + Intronic
1030968265 7:116021244-116021266 TTAAAAAGCACTACCATTAAAGG + Intronic
1031874916 7:127128534-127128556 ACAATAATTACTACCATTGAAGG - Intronic
1032997256 7:137461382-137461404 TTAATAATAACTACTATTGATGG - Intronic
1038156310 8:24994009-24994031 AGGAAAAATACTACCTTTGATGG - Intergenic
1038826179 8:31004698-31004720 TTGAAAAATAATCCCATTTAAGG - Intronic
1039952624 8:42183716-42183738 TTGAAAATCCCTTCCATTTATGG - Intronic
1040867273 8:52060844-52060866 TTGAAAATAACAAACATTGGTGG - Intergenic
1041326530 8:56672104-56672126 TGGAAAATTACAATCATTTATGG + Intergenic
1041957866 8:63576607-63576629 TTTAAAATAACTAATATTGAGGG - Intergenic
1042356547 8:67834782-67834804 TCAAAAGTAACTACCATTGAAGG + Intergenic
1042501902 8:69517588-69517610 ATGAACATTAATAGCATTGATGG + Intronic
1042873038 8:73415224-73415246 TGGAAAATTACTACCCATGAAGG + Intergenic
1042895533 8:73662996-73663018 TTCAAAATTAATTCCAGTGAAGG - Intronic
1044754883 8:95451123-95451145 TTGAATCTGACTACTATTGATGG - Intergenic
1044974805 8:97653793-97653815 TTGAAAACTACTAGCATAGCTGG - Intronic
1045771826 8:105750466-105750488 TTTAAAATTAATATCATTCAAGG + Intronic
1045943617 8:107769162-107769184 TTGAAATTTACGAGCATTCATGG + Intergenic
1046608738 8:116400930-116400952 TTGCAAGATACTACCTTTGAGGG + Intergenic
1048673766 8:136753270-136753292 TTGAAAATCATCACCATTTAAGG + Intergenic
1050275178 9:3989963-3989985 TTGCAAAATACTAACATTGGGGG + Intronic
1052109947 9:24569256-24569278 TTGAATATTCATACTATTGATGG + Intergenic
1052175825 9:25462197-25462219 TTCAAAATTACTTCCAGTAAAGG - Intergenic
1052716196 9:32120545-32120567 TTTAATTTTACTAGCATTGATGG + Intergenic
1052952203 9:34221665-34221687 TAGTAAATTACTTCCTTTGATGG - Intronic
1053373970 9:37589021-37589043 TTGAAAATAACTCCAAGTGATGG + Intronic
1053659175 9:40253809-40253831 TTGAAAAGTCTTACTATTGATGG - Intronic
1053909544 9:42883174-42883196 TTGAAAAGTCTTACTATTGATGG - Intergenic
1054360206 9:64106590-64106612 TTGAAAAGTCTTACTATTGATGG - Intergenic
1054371299 9:64400107-64400129 TTGAAAAGTCTTACTATTGATGG - Intronic
1054525424 9:66122413-66122435 TTGAAAAGTCTTACTATTGATGG + Intronic
1054678924 9:67889828-67889850 TTGAAAAGTCTTACTATTGATGG - Intronic
1054734552 9:68737456-68737478 TTGGAAATCACTTCCTTTGATGG - Intronic
1055768944 9:79695291-79695313 TTCAAAATTACTATTTTTGAAGG + Intronic
1056046760 9:82726415-82726437 TTGAAGATTATTACTATTAACGG + Intergenic
1057092311 9:92269545-92269567 CTGAAAATGACTATTATTGAAGG + Intronic
1059510953 9:114846259-114846281 TTGAAACTTACTTCTTTTGATGG - Intergenic
1060360074 9:122947102-122947124 TTGAAACTTACTTTTATTGAAGG + Intronic
1060862479 9:126966131-126966153 TTGAAATTAACTACCCTGGAAGG + Intronic
1203694403 Un_GL000214v1:82797-82819 TTGAAAAGTCTTACTATTGATGG + Intergenic
1203705151 Un_KI270742v1:34634-34656 TTGAAAAGTCTTACTATTGATGG - Intergenic
1203558858 Un_KI270744v1:31177-31199 TTGAAAAGTCTTACTATTGATGG + Intergenic
1203641870 Un_KI270751v1:21266-21288 TTGAAAAGTCTTACTATTGATGG - Intergenic
1186977177 X:14920327-14920349 TTGAGAATTCCTCCCAGTGATGG + Exonic
1187000909 X:15176620-15176642 TTAAAAATTAGTTCCAATGAGGG - Intergenic
1187654665 X:21457677-21457699 TGGAAAATTACTACAGTTGTGGG + Intronic
1187777821 X:22783377-22783399 TTGAAAGATGTTACCATTGAAGG + Intergenic
1188464930 X:30469078-30469100 TTGAAAATGGCTAACACTGAGGG - Intergenic
1188728057 X:33609180-33609202 ATGAAAATTACTACCATTCTGGG + Intergenic
1190967417 X:55313789-55313811 TTGCAAGATATTACCATTGAGGG - Intergenic
1192159110 X:68769584-68769606 TTGAGAGTCACTACCATAGATGG + Intergenic
1193194224 X:78610899-78610921 TGGAAAAATGCTATCATTGAGGG - Intergenic
1193807235 X:86009919-86009941 TTTAAAATTATTATTATTGATGG - Intronic
1193895242 X:87106581-87106603 TTTAAAATTACTACCCTCAAAGG + Intergenic
1194221867 X:91204144-91204166 TTGAAAGTTTTTTCCATTGATGG + Intergenic
1198626823 X:138584980-138585002 TTGAAATTTGTTACCATTAAGGG + Intergenic
1201576676 Y:15468569-15468591 ATGAATGTTACTACCATTGTCGG + Intergenic