ID: 919528705

View in Genome Browser
Species Human (GRCh38)
Location 1:198687522-198687544
Sequence ATGCCTTTATATATGAAACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 332
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 308}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919528705 Original CRISPR ATGCCTTTATATATGAAACA AGG (reversed) Intronic
903435815 1:23348362-23348384 ATGCCTCTATATAAAAATCATGG + Intergenic
903723939 1:25427220-25427242 ATTTCCTTATATGTGAAACAGGG + Intronic
905805598 1:40874762-40874784 ATGTTTTTATATATGCTACATGG + Intergenic
906418722 1:45644273-45644295 ATGCCTATTAAAATGAAACAAGG - Intronic
908693626 1:66811297-66811319 ATGCTTTTATAGAAGAAAAATGG + Intergenic
909515816 1:76506012-76506034 AAGGCACTATATATGAAACATGG + Intronic
909519373 1:76549105-76549127 ATCTCTTTATATTTGAAACATGG - Intronic
909675083 1:78230194-78230216 AGGCCTTAATAAATGATACATGG + Intergenic
910017391 1:82543798-82543820 ATGCATTTAAATAGGAAAGAAGG + Intergenic
910658765 1:89647239-89647261 ATGCTATTATGTATCAAACATGG + Intronic
911457839 1:98149638-98149660 ATGCATTTATATCTCAAAAAAGG - Intergenic
911457901 1:98150465-98150487 ATGCATTTATATCTCAAAAAAGG + Intergenic
915278266 1:154804710-154804732 ATGCTTTCATATATGTAAAAGGG - Intronic
915870429 1:159554320-159554342 AGGTATTTATATATGTAACAGGG - Intergenic
916901708 1:169231702-169231724 AGGCCTTTTTATATGATATATGG + Intronic
916997896 1:170321239-170321261 ATTCCTTTATGTTTGAACCAAGG - Intergenic
917188645 1:172389964-172389986 AGTTCTTTATCTATGAAACAGGG + Intronic
917303046 1:173598894-173598916 ATTCCTTTATTTTTGAAAAATGG - Intronic
918530730 1:185519050-185519072 ATGACTTTTTGTTTGAAACAGGG + Intergenic
918768854 1:188525942-188525964 ATGCATTTTTAAATGAAAAATGG + Intergenic
918835438 1:189458170-189458192 GTGCCATTATATATCAACCAAGG - Intergenic
918876703 1:190055541-190055563 ACTCTTTTATCTATGAAACAGGG + Intergenic
918903565 1:190459001-190459023 ATGACTTTATGTTTAAAACATGG + Intronic
919042285 1:192405470-192405492 ATACCTTTATTTATTATACATGG - Intergenic
919083647 1:192894782-192894804 ATGACTTTAGATAGGAAAGAAGG + Intergenic
919128736 1:193428028-193428050 ATGCCTTTCTCTCTGAAAGAGGG + Intergenic
919528705 1:198687522-198687544 ATGCCTTTATATATGAAACAAGG - Intronic
920809001 1:209264597-209264619 ATTTCCTTATCTATGAAACAGGG + Intergenic
920809463 1:209268464-209268486 ATTTCCTTATCTATGAAACAGGG + Intergenic
921454464 1:215351375-215351397 TTGCCTTTAGATATTAAAAAAGG - Intergenic
922866003 1:228862085-228862107 AAGCCTTTAAATATGGGACATGG - Intergenic
923392479 1:233527506-233527528 ATGCCATAATTTATAAAACAAGG + Intergenic
1070451504 10:76562493-76562515 ATGCATTTTTCTATGTAACATGG - Intergenic
1070538420 10:77397260-77397282 ATTTCTTTATATATAAAACAAGG + Intronic
1071096692 10:81983707-81983729 GTGCCTTTATACATGGAAGAAGG - Intronic
1071375319 10:84996334-84996356 ATTTCTTTATCTATAAAACAGGG - Intergenic
1072040798 10:91604320-91604342 ATGCATTTATATTAAAAACATGG + Intergenic
1072676186 10:97468077-97468099 ATCCTTTTATGTATGAGACAGGG + Intronic
1074352262 10:112749126-112749148 ATGCATTAATACATGAACCAAGG + Intronic
1074677724 10:115870669-115870691 ATATCTTTATATATCAATCAAGG + Intronic
1079139953 11:17801963-17801985 ATGTGTTTTTTTATGAAACAGGG - Intronic
1080138731 11:28889689-28889711 ATGCATTTATGAATAAAACATGG - Intergenic
1080365324 11:31567631-31567653 ATGCCTTTATATCAAAACCAAGG - Intronic
1080480416 11:32643074-32643096 ATGGATTTATATATGTAATATGG - Intronic
1080701509 11:34648379-34648401 ATGCTTTTATATATGATAATGGG + Intronic
1081464720 11:43305781-43305803 AGGCCTTTATATACAACACATGG - Intergenic
1087355510 11:97088635-97088657 ATGTCTCTACATATGAAATAGGG + Intergenic
1087533692 11:99416282-99416304 ATGCCTTTTTTTTTGAGACAAGG + Intronic
1087880501 11:103409961-103409983 ATACCTTTATATAAGATAAATGG + Intronic
1088541673 11:110919922-110919944 AAGCCTTTATAGGTGAATCATGG + Intergenic
1090039013 11:123274003-123274025 ATGACTTTATATCTGAAAAAAGG + Intergenic
1090858648 11:130633613-130633635 ATGCCTTTCTCTAGGAAAGAAGG - Intergenic
1090967022 11:131607672-131607694 ATGCTTTTGTCTATAAAACAAGG + Intronic
1091568599 12:1664866-1664888 ATTCATTTATTTTTGAAACAGGG - Intergenic
1092957830 12:13565920-13565942 ATGCCTCTATAGAGGAAAAAAGG - Intronic
1093442850 12:19219643-19219665 ATGCCTTTATTTTTAAAATATGG + Intronic
1095511668 12:42957459-42957481 GTGCTTTTATATATTAAAAAAGG + Intergenic
1097576795 12:61403988-61404010 ATGACTTTATATATGGAAATGGG - Intergenic
1097955333 12:65479483-65479505 ATGGCATTATAGAAGAAACAGGG - Intronic
1098619296 12:72572956-72572978 ATGTGTTTATATATTAAACTTGG + Intronic
1099019863 12:77390211-77390233 TTGCCTTTATTTATGCCACAGGG + Intergenic
1099417069 12:82403516-82403538 ATTCCTTCAGATATGAAAAAAGG - Intronic
1099916223 12:88897069-88897091 TTGACTTTATATTTGACACACGG + Intergenic
1100206812 12:92358724-92358746 ATGCCTATACATATAAAATAGGG - Intergenic
1100787043 12:98089713-98089735 GTGCCTCTATAGTTGAAACATGG - Intergenic
1103189109 12:118985479-118985501 ATGTCTTTAAAAATGAAAGAAGG + Intronic
1104185455 12:126426082-126426104 AGTCCTTGATATCTGAAACAAGG + Intergenic
1107638589 13:42417896-42417918 ATGCCTTCACACATGAAAGAAGG - Intergenic
1108477725 13:50837544-50837566 ATGCTTTTATATTAGAAAAAAGG - Intronic
1108720911 13:53131086-53131108 ATTCATTTACATATAAAACAAGG - Intergenic
1109887967 13:68567120-68567142 ATGCCCACATATATGGAACAAGG + Intergenic
1110754099 13:79151699-79151721 ATTTCTTCATATAGGAAACAAGG + Intergenic
1112394951 13:99021014-99021036 CTGCCTTGATTTATGAAATATGG - Intronic
1112989893 13:105499970-105499992 ATCCCTTTATAAATGAATAAAGG - Intergenic
1113191786 13:107757121-107757143 ATGCCTTTAAACAAGGAACAAGG + Intronic
1113221821 13:108112902-108112924 TTGCCTTTATCTATAAAATATGG + Intergenic
1115043739 14:28963228-28963250 ATGTGTTTTTATATAAAACATGG + Intergenic
1115141154 14:30172813-30172835 AGGCCTTTAAATATGGAAGAGGG + Intronic
1115150062 14:30274300-30274322 ATGTCTCTATATATTAAATATGG + Intergenic
1115315645 14:32022133-32022155 ATACATATATATATGAAAGAAGG + Intergenic
1116134933 14:40910478-40910500 ATGGTTTTATATATGAAATCAGG - Intergenic
1116397623 14:44465387-44465409 AAGCATTTATATAAGATACAGGG - Intergenic
1116679542 14:47948329-47948351 ATACCTTAATATATAAAAAAAGG - Intergenic
1116757162 14:48962357-48962379 ATGCTGTTATATATCATACACGG + Intergenic
1117075631 14:52100862-52100884 ATCCCTTTATCTGTTAAACAGGG + Intergenic
1117688779 14:58283438-58283460 ATGCCTTTAGGTGTGAAACTGGG - Intronic
1118331513 14:64819172-64819194 ATGACTTTCTTTATGAAACTGGG - Intronic
1118495215 14:66301683-66301705 ATGCATGTATATGTAAAACATGG - Intergenic
1119576936 14:75732845-75732867 ATGACTTTAAACATGAGACAGGG - Intronic
1120934344 14:89879219-89879241 ATGCCTTTAAATATAAAAGAAGG - Intronic
1121225576 14:92319469-92319491 AATACTTTATACATGAAACAGGG + Intergenic
1125188541 15:36962313-36962335 ATGCTTTTTCATCTGAAACAAGG + Intronic
1126152025 15:45532077-45532099 AGTCATTGATATATGAAACAGGG - Intergenic
1126757804 15:51941260-51941282 CTGCATTTATATATGACACTGGG - Intronic
1127425349 15:58850592-58850614 ATTTATTTATATATGAAACAGGG + Intronic
1127866427 15:63036954-63036976 TTGCTTTTAAATATGAAATAAGG + Intergenic
1132250107 15:100329589-100329611 ATACCTTTTAATAGGAAACAGGG - Intronic
1133482360 16:6183563-6183585 ATGCTGTTATATATGAGAGAGGG + Intronic
1134346407 16:13395978-13396000 ATCTCTTTTTATTTGAAACACGG + Intergenic
1135428179 16:22357814-22357836 AGGTTTTTATATATCAAACAAGG - Intronic
1135624924 16:23986258-23986280 ATGTATTTATTTTTGAAACAGGG + Intronic
1136315260 16:29451139-29451161 ATATTTTAATATATGAAACAGGG + Intronic
1136429837 16:30190481-30190503 ATATTTTAATATATGAAACAGGG + Intergenic
1136461434 16:30412939-30412961 ATTTCCTTATATATAAAACAGGG + Intronic
1137462560 16:48678686-48678708 ATGCCTTAACATATGAGACTTGG + Intergenic
1138465696 16:57187985-57188007 ATGCATATATATATGCAAAAGGG - Intronic
1138833428 16:60403933-60403955 TTTCCTTTATATATTAAATAAGG + Intergenic
1139254249 16:65525971-65525993 ATGCTTTTCTGTATGAAAAAAGG - Intergenic
1140131763 16:72168086-72168108 ATGTCTTCATTCATGAAACAAGG + Intronic
1140742969 16:77957912-77957934 ATGCATTTATTTTTGAGACAGGG + Intronic
1140813124 16:78597252-78597274 ATTCCTTCATATATTAATCAAGG + Intronic
1140899885 16:79357832-79357854 ATGCTTCTGTACATGAAACATGG - Intergenic
1141337140 16:83166643-83166665 ATGCCTGAATATATTAAATATGG - Intronic
1143254735 17:5547482-5547504 ATTTCTTTATATATGGAAAATGG + Intronic
1143809080 17:9455915-9455937 ATGCCTTTGCATATGAGAAATGG - Intronic
1144204547 17:12970544-12970566 ATCCCTTTATAGTTGAATCAAGG - Intronic
1144261286 17:13524262-13524284 AAGCCTATATATTTGAGACAGGG + Intronic
1146640316 17:34535876-34535898 AGACCTTTATATAAGAAAGAGGG - Intergenic
1152641428 17:81450899-81450921 ATACCTTTAAATTTGAGACAGGG - Intronic
1153486190 18:5601096-5601118 ATTCCTATATATCTGAATCATGG - Intronic
1153628081 18:7040758-7040780 ATGAATGGATATATGAAACATGG + Intronic
1155404600 18:25474064-25474086 AGGCTTTTAGATAGGAAACACGG - Intergenic
1156665723 18:39403824-39403846 ATGTCTTAATATGTGTAACAAGG + Intergenic
1156772937 18:40751224-40751246 ATTCCTTTTTATATGAAAAGAGG + Intergenic
1157023423 18:43814446-43814468 TTGCCTTTATAAGTCAAACATGG - Intergenic
1157932154 18:51834873-51834895 ATTACTTTATATAAGAAAAAAGG - Intergenic
1157996419 18:52562405-52562427 ATCCCTTTATATATAAAGTAAGG - Intronic
1158670311 18:59468376-59468398 ATGCATTTATTTTTGAGACAGGG - Intronic
1159146638 18:64462982-64463004 ATGTATTTATATAAGAAACTAGG + Intergenic
1159351265 18:67276849-67276871 ATGCCTTTACATATGTCAAATGG - Intergenic
1159363876 18:67440610-67440632 GTTCCTTAATATATGAAAGATGG - Intergenic
1159925423 18:74264756-74264778 CTGCTTTAATATGTGAAACAAGG + Intronic
1162557979 19:11399563-11399585 ACCCCTTTTTATTTGAAACAGGG - Intronic
1163339463 19:16695660-16695682 ATTCATTTATTTATGAGACAGGG - Intergenic
926589210 2:14721747-14721769 TGGCCTTTATATATAAAACTTGG - Intergenic
927324842 2:21792228-21792250 ATGCCTTTATTTATAAAGTAAGG - Intergenic
928011417 2:27611468-27611490 ATACCTTTTGATATGATACATGG - Intronic
928826086 2:35422917-35422939 ATATATATATATATGAAACATGG - Intergenic
929650075 2:43670231-43670253 TTTCCTTGATATCTGAAACATGG - Intronic
930233717 2:48868760-48868782 ATTCCTTTTTATTTGAAACAGGG - Intergenic
931563000 2:63583804-63583826 ATCCTATTTTATATGAAACATGG - Intronic
932622932 2:73276628-73276650 ATGCATTTATATATAACACATGG + Intronic
933037315 2:77416699-77416721 AAGCCTTTTTTTATTAAACATGG - Intronic
933040449 2:77458443-77458465 ATGGCTTTTTAAATAAAACAAGG - Intronic
933740365 2:85529249-85529271 CTGCCTTTTTTTTTGAAACAGGG + Intergenic
934726906 2:96627712-96627734 ATGACTTTATATAAGAAGAAAGG + Intronic
934966151 2:98724663-98724685 AGGCCTTTACATAAGAAACAAGG + Intronic
935406214 2:102712582-102712604 ATGCTTTTAAATATTAAATACGG + Intergenic
935656705 2:105429422-105429444 GTGTCCTTATATATGAAAGATGG + Intronic
937662621 2:124447699-124447721 ATGTATTTATATAGGAAACAGGG + Intronic
938858087 2:135336679-135336701 ATGAATTTTTTTATGAAACAGGG + Intronic
941280845 2:163548875-163548897 ATATCTTTCTATATGAAAGATGG + Intergenic
941326374 2:164120468-164120490 ATTCCTTTATAAATGTAAGACGG - Intergenic
941555764 2:166979128-166979150 ATGCCTTTTTTCATGGAACATGG + Intronic
941562183 2:167060224-167060246 AACCCTTTATGTATGAAATAGGG + Intronic
944460634 2:199945926-199945948 ATGCCCTTGTTTTTGAAACATGG - Intronic
945582822 2:211617523-211617545 ATGCCGGTAGATATGCAACAAGG + Intronic
945868923 2:215205883-215205905 AGGGCTTTATTTATAAAACAAGG + Intergenic
946022628 2:216651759-216651781 ATTCCTTTTTCTTTGAAACAAGG + Intronic
947036776 2:225867793-225867815 ATGCTTTTATATATGCATCATGG + Intergenic
948119558 2:235519077-235519099 ATGTGTTTATTTATGAGACAGGG + Intronic
948424921 2:237881133-237881155 AACCCTTTATATAAGAAAGAAGG - Intronic
1169340249 20:4790881-4790903 GTGCTTTTATATATAAAATAGGG + Intronic
1170575053 20:17656104-17656126 ATGCCTTTGTACATCAACCATGG + Intronic
1170654451 20:18273068-18273090 ATTCATTTATTTATGACACAGGG - Intergenic
1170751466 20:19151126-19151148 AGGCCTATATATTTGAAAAAAGG + Intergenic
1171224733 20:23432537-23432559 ATGCCTTTATTTATGGCAAATGG + Intergenic
1175012668 20:55755300-55755322 TTGCCTTTGTATATCAAAAAGGG + Intergenic
1178180693 21:30157777-30157799 ATGCTTCTGTCTATGAAACATGG + Intergenic
1178394740 21:32233146-32233168 ATGCCTTTATTCAGAAAACAAGG - Intergenic
1182242818 22:28930652-28930674 ATGCCTTTATAAATGTTCCATGG + Intronic
1182445872 22:30389137-30389159 ATGCATTTATTTTTGAGACAGGG + Intronic
1182709884 22:32314462-32314484 TTGACTTTATATTTGAAAGATGG - Intergenic
1183168815 22:36169068-36169090 ATGACTTTGTGTTTGAAACATGG - Intergenic
1183852297 22:40600544-40600566 ATACCTGTATATATTAAAAAGGG + Intronic
949132159 3:516485-516507 ATCCCTTTATTAATGTAACACGG + Intergenic
949239906 3:1858740-1858762 ATTCATTTATATATAATACATGG - Intergenic
949274786 3:2266581-2266603 GTGCCTGTATATATGAGACAAGG + Intronic
950412280 3:12846793-12846815 ATGACCTTAGATATGAGACATGG + Intronic
951186340 3:19717845-19717867 ATGCCTTTATATATCAAGGCAGG + Intergenic
951858082 3:27220434-27220456 ATGTCTTTAAACATGAAAAAGGG - Intronic
954874931 3:53795958-53795980 AACCCTTTATATCTGACACAAGG + Intronic
957515029 3:81239219-81239241 TTGCTTTTGTATATGAAAAATGG + Intergenic
958069296 3:88588987-88589009 GTGCCTTTATCTATTAAAAATGG - Intergenic
958914312 3:100031476-100031498 TTTCCTTTATATTTGAAAAAAGG - Intronic
959378270 3:105611344-105611366 GTGTCTTTAAATATAAAACAAGG - Intergenic
959589915 3:108067753-108067775 AGGCCTTTATCTTTGAAACGTGG + Intronic
959866210 3:111273325-111273347 AGACCTTGATATTTGAAACATGG + Intronic
961851320 3:129822054-129822076 ATGTATTTATATTTGAGACAGGG - Intronic
962880888 3:139575449-139575471 ATGTCCTTATATATAAAATAGGG + Intronic
963386936 3:144609250-144609272 TTTCCTTTATATTTAAAACAGGG - Intergenic
964530546 3:157663160-157663182 ATGCATTTATTTATGAAACAGGG - Intronic
965469123 3:169068508-169068530 ATACCTTTGTATATGAATTATGG + Intergenic
965957243 3:174386159-174386181 ATCTTTTTATCTATGAAACAGGG - Intergenic
966189374 3:177258355-177258377 AAGCCATTATATATAATACAAGG - Intergenic
966450530 3:180055110-180055132 ATACGTATATATATGAGACAAGG - Intergenic
966699247 3:182827180-182827202 ATAACTTCATACATGAAACAGGG - Intronic
967743618 3:193030385-193030407 ATGATTTTTTATATAAAACATGG - Intergenic
969779151 4:9382793-9382815 AAGGCTGTATAAATGAAACAAGG + Intergenic
969848493 4:9938191-9938213 ATGACTTTATATATTAAGCCAGG - Intronic
970028013 4:11644519-11644541 ATGCCTTTAAAAAAGAAAAATGG + Intergenic
970499176 4:16659695-16659717 ATGTATGTATATATGTAACAAGG + Intronic
971873764 4:32276942-32276964 ATTCTTTTATATAGGAAGCAGGG - Intergenic
972183836 4:36503408-36503430 ATGCTTGTATATATGTAAAATGG + Intergenic
972649525 4:41003372-41003394 ATTCCTTAATAGATGCAACATGG - Intronic
972846050 4:42990822-42990844 ATGCATATATATATGTAAAAAGG - Intronic
973634254 4:52847192-52847214 ATGCCTTTAGCTAAGAAAGAAGG - Intergenic
974135768 4:57815488-57815510 ATGCCTTTGTATATGCAGCAAGG - Intergenic
974946786 4:68538101-68538123 ATACCTTTAAAAATGAAAAATGG + Intronic
974956498 4:68647580-68647602 ATACCTTTAAAAATGAAAAATGG + Intronic
975787698 4:77910146-77910168 ATGCCTTCATCTATAAGACAGGG - Intronic
976391286 4:84506983-84507005 TTGTGTTTATATATTAAACAGGG + Intergenic
976575271 4:86662801-86662823 ATGCATTTGTATATCAGACAGGG + Intronic
976885636 4:89980275-89980297 ATGCCATTATATATTAAAAGGGG + Intergenic
978103208 4:104868799-104868821 ATGTATATATATATGAGACAAGG + Intergenic
978190505 4:105905479-105905501 ATGCCATCATTTATGAAAAAGGG - Intronic
978775625 4:112503699-112503721 ATGCCTTTAAAAATGAAAACTGG - Intergenic
979422218 4:120518983-120519005 ATTCTTTTGTATATGAATCAGGG - Intergenic
979502840 4:121459949-121459971 ATTCCTTTATCTGTGAAATAGGG + Intergenic
980549452 4:134315143-134315165 AAACCTTCATATATGGAACATGG + Intergenic
981029782 4:140112808-140112830 ATGCAATTATATATGTAAAATGG - Intronic
982885729 4:160779846-160779868 GTGGCTTTATATATGTAAAATGG + Intergenic
983719327 4:170827825-170827847 GTTTCTTTATATGTGAAACAGGG + Intergenic
983911204 4:173241635-173241657 ATACCTTTGTTTTTGAAACAGGG + Intronic
986551249 5:8958481-8958503 ATGCCTTTTAATTTCAAACATGG - Intergenic
986699466 5:10391902-10391924 ATGTTTTTTTCTATGAAACAGGG + Intronic
987454863 5:18130792-18130814 ATTTATTTATTTATGAAACAGGG - Intergenic
987622213 5:20349118-20349140 ATTCCTTTAGTTATGGAACAAGG - Intronic
989225122 5:39018332-39018354 ATGGCTATATTTATGAAATATGG + Intronic
989228503 5:39059140-39059162 ATAACTTTATATATACAACATGG + Intronic
989471608 5:41826004-41826026 CTGCCTTTGTATTTGAAATATGG - Intronic
990613539 5:57483869-57483891 CTGTATTTCTATATGAAACATGG - Intergenic
990804740 5:59646597-59646619 ATATCTTTATATATAAAACTGGG + Intronic
991998646 5:72413721-72413743 ATTTCTTTATTTATGACACAAGG + Intergenic
992311383 5:75503512-75503534 TTTCCTTTAAATATGTAACATGG + Intronic
992581164 5:78178142-78178164 ATGCCTTTCTAAATGAAGCCAGG + Intronic
993547339 5:89229507-89229529 ATGCCTGCATATATGCACCAAGG - Intergenic
993831663 5:92767605-92767627 ATACATTTATTTATGAAAAAAGG - Intergenic
993962554 5:94317674-94317696 ACGTCTTAATCTATGAAACAGGG + Intronic
994181711 5:96774626-96774648 ATGCCTTGATTAATGAAACATGG - Exonic
996780675 5:127183361-127183383 AAGAGTTTAAATATGAAACATGG - Intergenic
996822827 5:127649577-127649599 ATGCCTTTATTTTTAAAGCATGG + Intronic
997437649 5:133886504-133886526 ATGTATGTATATATAAAACAAGG - Intergenic
998311139 5:141133748-141133770 ATAGCTTTAAATATGAAAAATGG + Intronic
999592325 5:153161703-153161725 ATTCCTTAAAATATCAAACATGG - Intergenic
1000849576 5:166323383-166323405 ATGCCTTTATATATAAGGTACGG + Intergenic
1003522368 6:6869044-6869066 ATGCCTTTATTTGTGAAAAGGGG - Intergenic
1004733035 6:18376998-18377020 ATACATATATATATAAAACAAGG - Intergenic
1004775096 6:18835232-18835254 ATGCCTTTTTATCTGAAATTTGG - Intergenic
1005403218 6:25457003-25457025 ATGCTTTTATAAATGAGACCAGG - Intronic
1008593877 6:53021511-53021533 ACTCCTTTTTATATTAAACAGGG + Intronic
1010029344 6:71256990-71257012 ATGTCTATAAAAATGAAACATGG - Intergenic
1010752350 6:79629949-79629971 TTGCATTTATATAGGAAATACGG + Intergenic
1011896605 6:92235354-92235376 CTGCCTTAATATAGGAAAGAAGG - Intergenic
1012044924 6:94261351-94261373 ATGCCTTTGGATATGAAGCATGG + Intergenic
1013751411 6:113411121-113411143 TTGCCTTTATATGTGTAACAAGG - Intergenic
1014004834 6:116406195-116406217 ATACCTTTTTAAATGCAACATGG + Intronic
1014014125 6:116510287-116510309 ATGTATTTATTTATGAGACAGGG + Intronic
1014730009 6:125021727-125021749 ATGACTTTATAAAGGAAACTGGG - Intronic
1014867881 6:126554286-126554308 ATACATATATATATGTAACAGGG - Intergenic
1015410041 6:132883925-132883947 ATTTCTTTATCTATAAAACAGGG - Intergenic
1016334334 6:142988409-142988431 ATGCCTTAAAATATGAAAATTGG - Intergenic
1016522219 6:144959048-144959070 ATGAATTTATTTAGGAAACATGG - Intergenic
1017961319 6:159223664-159223686 TTGTCTTTATATATGAGAGATGG + Intronic
1017993962 6:159514833-159514855 ATCCCTTATTTTATGAAACAAGG + Intergenic
1018674900 6:166211244-166211266 ATGCATATATATATGAAAAGAGG + Intergenic
1021806781 7:24365186-24365208 ATGTCTTCTTATAAGAAACAAGG - Intergenic
1021908070 7:25355369-25355391 ATGCTTTTAAAAATGATACAGGG - Intergenic
1022563758 7:31376020-31376042 ATGTATTTATTTATGACACAAGG - Intergenic
1023810822 7:43910220-43910242 ATTCATTTATTTATGAGACACGG + Intronic
1024113988 7:46174739-46174761 ATGTTTTTATATATGTAACTTGG - Intergenic
1025016989 7:55447619-55447641 ATGCATATGTATATGAAATATGG - Intronic
1027570736 7:79863253-79863275 ATGCATATATATATAAAATAGGG - Intergenic
1028016060 7:85714583-85714605 TTGACTTTATATATGTAAGATGG + Intergenic
1029462599 7:100705159-100705181 ATGCATTTATTTTTGAGACAGGG - Intergenic
1030109764 7:106017248-106017270 ATGCCTTTATATAGGCTCCAGGG - Intronic
1030448379 7:109676679-109676701 AATCCTTTATACAGGAAACAAGG - Intergenic
1030959419 7:115897191-115897213 ATGCCTATATTTAGGAAGCAAGG - Intergenic
1031002093 7:116427566-116427588 ATCTATTTATAAATGAAACATGG - Intronic
1033056298 7:138058079-138058101 ATGTCTTTATATAAGAGAGAGGG - Intronic
1034140262 7:148808887-148808909 ATCCATTTATATATTATACAAGG - Intronic
1037072694 8:14671810-14671832 ATGCCTATATATATTCAATACGG - Intronic
1037180233 8:15996076-15996098 GTACCTTTATATAAGAAAAAAGG - Intergenic
1037567843 8:20132535-20132557 GTGTCTTCATCTATGAAACAGGG - Intergenic
1038775699 8:30528659-30528681 ATGACTATATTTATGTAACAGGG - Intronic
1038936517 8:32257904-32257926 ATGGTTTTATATGTTAAACAGGG - Intronic
1038986939 8:32821628-32821650 ATGACTTTGTCAATGAAACATGG + Intergenic
1039088875 8:33806883-33806905 GTGCCTTCCTATGTGAAACAGGG - Intergenic
1039693720 8:39887734-39887756 CTGCCTTTATATTTAAAATAGGG - Intergenic
1039825149 8:41166913-41166935 ATGCCTTTTAAAATGAAACAAGG - Intergenic
1040810202 8:51444107-51444129 ATGCTGTTATTGATGAAACAGGG - Intronic
1041134920 8:54747819-54747841 CAGGCTATATATATGAAACAGGG - Intergenic
1041406648 8:57506588-57506610 ATGCCTGAATAAATGAAAGATGG + Intergenic
1041613301 8:59876186-59876208 ATCCCTTAATATATTAATCATGG - Intergenic
1041635737 8:60141046-60141068 ATGAGTTTATTTATGAAAGATGG - Intergenic
1041968060 8:63703794-63703816 GTGTCTTTATCTATGAAATAAGG + Intergenic
1043467988 8:80532969-80532991 TTGTCTTTATATCTAAAACATGG - Intergenic
1046349045 8:112981801-112981823 ATACCTTTTTATATGAAATATGG + Intronic
1046434988 8:114175847-114175869 ATGCCTTTCTTAATGAAATATGG - Intergenic
1046738268 8:117800910-117800932 ATCCCTGTTTTTATGAAACATGG + Intronic
1047153012 8:122285649-122285671 ATGCATTTCTTTTTGAAACAGGG + Intergenic
1047889290 8:129290221-129290243 TTGCCTCCATATATGAAAGATGG - Intergenic
1048989218 8:139751510-139751532 ATGACTTTAGAAGTGAAACAGGG - Intronic
1050000623 9:1073634-1073656 ATGTCCTTATATGTAAAACAAGG - Intergenic
1052519173 9:29522340-29522362 TTACCTTTACATATGACACAAGG - Intergenic
1052732442 9:32305349-32305371 ATGCCTTCATTTATGAAATTGGG - Intergenic
1052781669 9:32787479-32787501 ACTCCTTTCTATATGCAACAAGG + Intergenic
1053835673 9:42132434-42132456 ATGTGTTTATATATGAGCCAAGG - Intergenic
1054594956 9:67056171-67056193 ATGTGTTTATATATGAGCCAAGG + Intergenic
1056630869 9:88291996-88292018 ATGCCTTTTGAAATGTAACATGG - Intergenic
1186227405 X:7414629-7414651 ATGCTTGTATAAATGAAACATGG + Intergenic
1186917710 X:14241750-14241772 ATGCCTTTATATAATATATATGG + Intergenic
1187629161 X:21148911-21148933 TTGGTTTTATATATGAAACCTGG - Intergenic
1187906981 X:24076002-24076024 AAGCCTTAATAAAGGAAACAGGG - Intronic
1187945890 X:24426168-24426190 ATGTGTTTATTTTTGAAACATGG - Intergenic
1188625808 X:32283748-32283770 ATCCATTTATATATTATACATGG + Intronic
1193168291 X:78306517-78306539 AAGTCTTTATTTATAAAACAGGG - Intronic
1194414248 X:93590995-93591017 ATGCCTTTAAAAATGTAAGACGG - Intergenic
1194871193 X:99133797-99133819 GTGCCTTTAGATATGTAAGAGGG - Intergenic
1194891718 X:99386781-99386803 ATATGTATATATATGAAACATGG + Intergenic
1195338064 X:103876952-103876974 AAGCCTTTATATATCTATCAGGG + Intergenic
1196330238 X:114464244-114464266 ATTTCTTTATCTATGAAACAGGG - Intergenic
1196850998 X:119938903-119938925 TTCCCTTTATATTTTAAACATGG + Intronic
1197320685 X:125025949-125025971 ATGCCTTTATTCATTAAAGATGG + Intergenic
1197559211 X:127996959-127996981 GTGCATTTCTATATGTAACAGGG + Intergenic
1198573030 X:137978425-137978447 CTACCTTTATATATGACAGAAGG - Intergenic
1198997524 X:142590958-142590980 ATACCTTTATATAAGAAAATTGG - Intergenic
1200971585 Y:9158312-9158334 ATGCCTCTGTATATGAATCAGGG + Intergenic
1201706725 Y:16945918-16945940 ATGAGTTAATATATGAAATACGG - Intergenic
1201975324 Y:19842764-19842786 ATGCCTCTATATATCTATCAGGG + Intergenic
1202094015 Y:21225947-21225969 ATGCATTTATATATGAATAAAGG - Intergenic
1202139433 Y:21705985-21706007 ATGCCTCTGTATATGAATCAGGG - Intergenic