ID: 919536715

View in Genome Browser
Species Human (GRCh38)
Location 1:198796832-198796854
Sequence ATTAGACAGTGCCCCAGTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919536708_919536715 -8 Left 919536708 1:198796817-198796839 CCATCCCACAGCTCCATTAGACA No data
Right 919536715 1:198796832-198796854 ATTAGACAGTGCCCCAGTGGGGG No data
919536706_919536715 -1 Left 919536706 1:198796810-198796832 CCCTCTTCCATCCCACAGCTCCA No data
Right 919536715 1:198796832-198796854 ATTAGACAGTGCCCCAGTGGGGG No data
919536707_919536715 -2 Left 919536707 1:198796811-198796833 CCTCTTCCATCCCACAGCTCCAT No data
Right 919536715 1:198796832-198796854 ATTAGACAGTGCCCCAGTGGGGG No data
919536705_919536715 20 Left 919536705 1:198796789-198796811 CCGGGGTATGGAGGATGGTAGCC No data
Right 919536715 1:198796832-198796854 ATTAGACAGTGCCCCAGTGGGGG No data
919536703_919536715 25 Left 919536703 1:198796784-198796806 CCACTCCGGGGTATGGAGGATGG No data
Right 919536715 1:198796832-198796854 ATTAGACAGTGCCCCAGTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919536715 Original CRISPR ATTAGACAGTGCCCCAGTGG GGG Intergenic
No off target data available for this crispr