ID: 919545124

View in Genome Browser
Species Human (GRCh38)
Location 1:198906577-198906599
Sequence ACTAGTACATTGTGCTCTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919545124_919545125 -3 Left 919545124 1:198906577-198906599 CCATGAGAGCACAATGTACTAGT No data
Right 919545125 1:198906597-198906619 AGTCTTTAGATGAATCAAACAGG No data
919545124_919545126 7 Left 919545124 1:198906577-198906599 CCATGAGAGCACAATGTACTAGT No data
Right 919545126 1:198906607-198906629 TGAATCAAACAGGAAAAATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919545124 Original CRISPR ACTAGTACATTGTGCTCTCA TGG (reversed) Intergenic
No off target data available for this crispr