ID: 919545125

View in Genome Browser
Species Human (GRCh38)
Location 1:198906597-198906619
Sequence AGTCTTTAGATGAATCAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919545123_919545125 10 Left 919545123 1:198906564-198906586 CCTTTCTTTGGCTCCATGAGAGC No data
Right 919545125 1:198906597-198906619 AGTCTTTAGATGAATCAAACAGG No data
919545124_919545125 -3 Left 919545124 1:198906577-198906599 CCATGAGAGCACAATGTACTAGT No data
Right 919545125 1:198906597-198906619 AGTCTTTAGATGAATCAAACAGG No data
919545122_919545125 13 Left 919545122 1:198906561-198906583 CCTCCTTTCTTTGGCTCCATGAG No data
Right 919545125 1:198906597-198906619 AGTCTTTAGATGAATCAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919545125 Original CRISPR AGTCTTTAGATGAATCAAAC AGG Intergenic
No off target data available for this crispr