ID: 919545281

View in Genome Browser
Species Human (GRCh38)
Location 1:198909814-198909836
Sequence AAAAAGAAAACATTTTTTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919545281_919545284 9 Left 919545281 1:198909814-198909836 CCTGAAAAAAATGTTTTCTTTTT No data
Right 919545284 1:198909846-198909868 TTAGAGAATAAGCAGTTGGTGGG No data
919545281_919545282 5 Left 919545281 1:198909814-198909836 CCTGAAAAAAATGTTTTCTTTTT No data
Right 919545282 1:198909842-198909864 TTTCTTAGAGAATAAGCAGTTGG No data
919545281_919545283 8 Left 919545281 1:198909814-198909836 CCTGAAAAAAATGTTTTCTTTTT No data
Right 919545283 1:198909845-198909867 CTTAGAGAATAAGCAGTTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919545281 Original CRISPR AAAAAGAAAACATTTTTTTC AGG (reversed) Intergenic
No off target data available for this crispr