ID: 919545283

View in Genome Browser
Species Human (GRCh38)
Location 1:198909845-198909867
Sequence CTTAGAGAATAAGCAGTTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919545281_919545283 8 Left 919545281 1:198909814-198909836 CCTGAAAAAAATGTTTTCTTTTT No data
Right 919545283 1:198909845-198909867 CTTAGAGAATAAGCAGTTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919545283 Original CRISPR CTTAGAGAATAAGCAGTTGG TGG Intergenic
No off target data available for this crispr