ID: 919545284

View in Genome Browser
Species Human (GRCh38)
Location 1:198909846-198909868
Sequence TTAGAGAATAAGCAGTTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919545281_919545284 9 Left 919545281 1:198909814-198909836 CCTGAAAAAAATGTTTTCTTTTT No data
Right 919545284 1:198909846-198909868 TTAGAGAATAAGCAGTTGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919545284 Original CRISPR TTAGAGAATAAGCAGTTGGT GGG Intergenic
No off target data available for this crispr