ID: 919546309

View in Genome Browser
Species Human (GRCh38)
Location 1:198923888-198923910
Sequence TGCTATAATGCCTATGGGAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919546309_919546312 -4 Left 919546309 1:198923888-198923910 CCTATCCCATAGGCATTATAGCA No data
Right 919546312 1:198923907-198923929 AGCATCTTGAGCTTATAACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919546309 Original CRISPR TGCTATAATGCCTATGGGAT AGG (reversed) Intergenic
No off target data available for this crispr