ID: 919550741

View in Genome Browser
Species Human (GRCh38)
Location 1:198983405-198983427
Sequence TATCCCTTTCCCATTGGCAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 3, 3: 13, 4: 155}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919550738_919550741 1 Left 919550738 1:198983381-198983403 CCTTCTTTCCATACGAGGATTAC 0: 1
1: 0
2: 0
3: 1
4: 59
Right 919550741 1:198983405-198983427 TATCCCTTTCCCATTGGCATTGG 0: 1
1: 0
2: 3
3: 13
4: 155
919550737_919550741 2 Left 919550737 1:198983380-198983402 CCCTTCTTTCCATACGAGGATTA 0: 1
1: 0
2: 0
3: 10
4: 119
Right 919550741 1:198983405-198983427 TATCCCTTTCCCATTGGCATTGG 0: 1
1: 0
2: 3
3: 13
4: 155
919550739_919550741 -7 Left 919550739 1:198983389-198983411 CCATACGAGGATTACATATCCCT 0: 1
1: 0
2: 1
3: 1
4: 43
Right 919550741 1:198983405-198983427 TATCCCTTTCCCATTGGCATTGG 0: 1
1: 0
2: 3
3: 13
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919550741 Original CRISPR TATCCCTTTCCCATTGGCAT TGG Intergenic
900776409 1:4588921-4588943 TATCCTGTACCCATTGGCATTGG + Intergenic
900800177 1:4732375-4732397 TCTCCCTTTCCCTTTCACATAGG - Intronic
904919515 1:33996098-33996120 TATCCTTTGCCCATTTTCATAGG - Intronic
906752356 1:48277060-48277082 GATCCCTTTACCATTAGCAATGG + Intergenic
906846802 1:49201181-49201203 TATCCCCTTCCCATTTTCCTTGG + Intronic
908671936 1:66557597-66557619 TATCCCAATCCCATTGCCAGAGG - Intronic
909190454 1:72542761-72542783 TAGCCCTAACCCATTGGCATGGG + Intergenic
909486367 1:76178859-76178881 TAAGCCTTACCCATTGGCCTTGG + Intronic
911084209 1:93963157-93963179 TATCCATTTCCCATAGGTAAAGG + Intergenic
913972102 1:143423415-143423437 TCTCCCTTGCCCACTGGCACGGG - Intergenic
914066483 1:144249028-144249050 TCTCCCTTGCCCACTGGCACGGG - Intergenic
914112670 1:144717326-144717348 TCTCCCTTGCCCACTGGCACGGG + Intergenic
915164645 1:153941834-153941856 TAACCCCTTCCCAATGGCAGAGG + Intronic
915193646 1:154172847-154172869 TATCCCTTCCCCTTTGGCTTGGG - Intronic
916597133 1:166254642-166254664 CATCCCTTCCCCATTGACTTTGG - Intergenic
916764296 1:167845401-167845423 TTTCTCTTCCCCATTGGCCTAGG + Intronic
918783901 1:188738996-188739018 TTTTCCTTTCCCATTGATATTGG - Intergenic
919301965 1:195781671-195781693 AATTCATTTCCCATTGTCATCGG - Intergenic
919550741 1:198983405-198983427 TATCCCTTTCCCATTGGCATTGG + Intergenic
919966271 1:202528980-202529002 TATGCCTTTCACATTTCCATTGG - Intronic
921963753 1:221065288-221065310 TCTCACTTTCCCAGGGGCATCGG + Intergenic
1064078595 10:12289893-12289915 TACCCCTGTCCCCTTGACATTGG - Intergenic
1064735227 10:18375300-18375322 TATCTTTTTCCCTATGGCATTGG - Intronic
1066689020 10:38008339-38008361 TGTCCCTTCCCCATTGGCTGGGG - Intergenic
1067472637 10:46547810-46547832 CATGCCTTTCCCATATGCATAGG - Intergenic
1070962620 10:80509665-80509687 CAGCCCTTTCCCATTGGGATTGG + Intronic
1072141287 10:92591381-92591403 TATCTTTTTCCCATTGGCTGGGG - Intergenic
1074860505 10:117506523-117506545 TTTCACTATCCCATTGGCAGGGG + Intergenic
1077307752 11:1875618-1875640 TCTCCCTTGCCCACTGGCGTGGG + Intronic
1078374091 11:10778203-10778225 TTTCCCTGTCCTATTGCCATCGG - Intronic
1080351287 11:31387784-31387806 TATCTCTATCTCTTTGGCATTGG - Intronic
1082958345 11:58895800-58895822 TATCCCTTTTCTATTGGCATAGG - Intronic
1082965082 11:58958995-58959017 TATCCCTTTTCTATTGGCATAGG - Intronic
1082973929 11:59053798-59053820 TATCCCTTTTCTATTTGCATAGG - Intergenic
1082978340 11:59097608-59097630 TATCCCTTTTCTATTTGCATAGG - Intergenic
1083384322 11:62296519-62296541 TCTGCCTTTCCAATTGCCATTGG - Intronic
1084506892 11:69574127-69574149 CATGCATTTCCCATTGGCTTAGG + Intergenic
1086290860 11:85307636-85307658 CATCTCTTTCCCATTGGTGTTGG - Intronic
1087517413 11:99181419-99181441 TATCCCACCCCCATTGGTATTGG + Intronic
1088422756 11:109667367-109667389 TTTCCCTCTCCCAGTGGCACAGG - Intergenic
1092695712 12:11169424-11169446 TATTCCCGTCCCATTGGAATAGG + Intronic
1094675675 12:32617888-32617910 TATCCTTTTCCTCTTCGCATAGG - Intronic
1095408890 12:41900449-41900471 TATCCCTTTCCCATTGTGTGTGG - Intergenic
1096188867 12:49601544-49601566 TTTCCCTTTCCCATTAGCACTGG + Intronic
1098097626 12:66976055-66976077 TCTCCCTTCCCCAGTTGCATAGG + Intergenic
1102397988 12:112603841-112603863 CATCCCTTTCCCTTTGTCAGAGG - Intronic
1102601191 12:114032099-114032121 TTTGCCTTTCCCATTTGCCTTGG + Intergenic
1102666391 12:114577660-114577682 TTTCCGTTTACCATTGCCATGGG - Intergenic
1103799293 12:123526869-123526891 TCTCTGTTTCCAATTGGCATAGG + Intronic
1104997410 12:132667161-132667183 TATCTCTTTCCCGCTGTCATGGG - Intronic
1106406061 13:29474678-29474700 TATCTATATCCCATTGGCACAGG + Intronic
1106614470 13:31314158-31314180 TTTCCCTTCCCCACTAGCATAGG - Intronic
1109304565 13:60624492-60624514 TATTTCCATCCCATTGGCATGGG - Intergenic
1109778245 13:67072314-67072336 TATCCCTTTCCTCTGGGTATAGG - Intronic
1113072172 13:106432713-106432735 AATCCCTTTCTCCTTGGCAGTGG + Intergenic
1114361276 14:21975782-21975804 TACCCTTTTGCCATCGGCATTGG - Intergenic
1114684712 14:24517759-24517781 CATCCCTTTCCCATGGGTTTGGG + Intergenic
1115034298 14:28838517-28838539 CACCCATTTCCCATTGGCAAAGG - Intergenic
1116707082 14:48315951-48315973 TATCCCTTTCCCCACAGCATGGG + Intergenic
1118300575 14:64612042-64612064 TGTCCCTTTCAGATTGGCCTTGG + Intergenic
1118599637 14:67462880-67462902 GACCCCTTTCCCATTGGCTATGG - Intronic
1119068819 14:71559447-71559469 TTTCCCCTGCCCAGTGGCATTGG + Intronic
1119085741 14:71737324-71737346 TAGCTCTTTCCCATTGGCGCTGG + Intronic
1119374741 14:74180733-74180755 TTTCACTTTCACTTTGGCATTGG + Intronic
1120140028 14:80919563-80919585 TATACTGTTCCCATAGGCATGGG + Intronic
1121175623 14:91888819-91888841 AGTCTCTTTCCCACTGGCATTGG + Intronic
1121877513 14:97467046-97467068 TATCCTTTTCCCATTGGCTTGGG + Intergenic
1122063114 14:99150155-99150177 TCTGCCTTTCCCATTGAAATGGG + Intergenic
1123488676 15:20763314-20763336 TATCCCCTTCCCATGGGGAGGGG + Intergenic
1126040499 15:44585850-44585872 TATCCTTTTCTCTTTGGCACAGG - Exonic
1126212949 15:46120398-46120420 TACCCCTTTCCCAATGCTATAGG - Intergenic
1128459262 15:67853847-67853869 TAACCCTTTTCTATTGGCACAGG + Intergenic
1128506077 15:68273764-68273786 CAGCCCTTCCCCATTGGCATGGG + Intergenic
1129631756 15:77267643-77267665 CTTCCCTTTCCCATAGGGATGGG - Intronic
1131469103 15:92680552-92680574 TATCCCATTCCCATTGTTATAGG + Intronic
1138064570 16:53927195-53927217 TACCCCTTCCCCACTGCCATAGG - Intronic
1138310923 16:56023147-56023169 CATCCCTGTCCCCCTGGCATGGG - Intergenic
1139647082 16:68339148-68339170 TTTCCCTTTTCCAAGGGCATAGG + Intronic
1139969286 16:70763692-70763714 TATCCGTTTCTCATAGGCAGAGG - Intronic
1141316076 16:82963775-82963797 TACCCATTTCCCCTTGGCACGGG + Intronic
1141439887 16:84023282-84023304 TACCCTTTTCCCATTGGCTGGGG - Intronic
1145098487 17:20053016-20053038 AATCCCTTACCCATTGACTTGGG - Intronic
1145752174 17:27363011-27363033 TTTCACTTTCCCACTGGCCTTGG - Intergenic
1147937446 17:44020747-44020769 TATCCCACTCCCATTGGTATTGG + Intronic
1148341020 17:46873444-46873466 AAGCCCTTTCCCCTTGGCAAGGG - Intronic
1152099447 17:78292462-78292484 TATCCCTTTGACATTCGCCTTGG - Intergenic
1157473638 18:48008106-48008128 CACCCCCTTCCCATTGGCAAAGG - Intergenic
1163326279 19:16605458-16605480 TATCCATTTCCCCTTTCCATGGG - Intronic
1167291401 19:48627219-48627241 TATCCTCTTCCCCTTTGCATGGG + Intronic
925637916 2:5959916-5959938 CTTCCCTTTCCCATAGGAATAGG + Intergenic
928864011 2:35895787-35895809 TATCCCTATCCCAGGGGGATAGG + Intergenic
930989965 2:57641300-57641322 TATTCCTACCCCATTGCCATGGG - Intergenic
931139054 2:59436883-59436905 TATCCCTTTCCCATACCCACAGG - Intergenic
933227542 2:79768213-79768235 TGTCCCTTTCCCAGTGCCAGAGG + Intronic
938799235 2:134745529-134745551 TATCCTGTTCCCATTCACATTGG + Intergenic
946497772 2:220213288-220213310 CATCCTTTTCCTATTGGCAAAGG - Intergenic
947063607 2:226194829-226194851 TAACCCCTACCCATTGGCACCGG + Intergenic
1168939976 20:1701026-1701048 GATCCCATTCTCATTGCCATTGG - Intergenic
1169272397 20:4210698-4210720 TTTCCCTGCCCCATTGGCTTTGG + Intergenic
1169448852 20:5694322-5694344 TGTCTCTTTCCCATTAGGATTGG + Intergenic
1176332020 21:5558076-5558098 TTTTCCTTTCTCCTTGGCATAGG + Intergenic
1176395737 21:6262875-6262897 TTTTCCTTTCTCCTTGGCATAGG - Intergenic
1176441420 21:6726229-6726251 TTTTCCTTTCTCCTTGGCATAGG + Intergenic
1176465682 21:7053298-7053320 TTTTCCTTTCTCCTTGGCATAGG + Intronic
1176489243 21:7435076-7435098 TTTTCCTTTCTCCTTGGCATAGG + Intergenic
1177448274 21:21228046-21228068 TAACCCTTTATCAGTGGCATGGG - Intronic
950978121 3:17271938-17271960 TTTTCCTTTCACATTGGCCTTGG - Intronic
952024924 3:29068209-29068231 TATCACTTTCACATTTGCACAGG + Intergenic
952160882 3:30691782-30691804 TATGCCTTTGACATTGTCATAGG + Exonic
956133629 3:66077526-66077548 TATCCCTTTTCCATAGTGATTGG - Intergenic
957552161 3:81719975-81719997 TATCACTTTGACAATGGCATAGG + Intronic
958444159 3:94194586-94194608 TATACCTTTCCTCTTGGTATGGG + Intergenic
961915546 3:130370238-130370260 TTTCACTTTTCCTTTGGCATGGG + Intronic
963000766 3:140679753-140679775 TATCCCTTTCCTGTTGAAATGGG - Intronic
963206976 3:142646542-142646564 TATCCCTTTACTACAGGCATGGG + Intronic
964781383 3:160342124-160342146 GATACCTTTTCCATGGGCATCGG - Intronic
965969245 3:174533159-174533181 TACCCCTTCCCCATTGGCTGGGG - Intronic
968004507 3:195231349-195231371 TCTTCCTTTCCCATTTGGATAGG + Intronic
971002333 4:22337328-22337350 TATCCCACCCCCATTGGTATTGG + Intergenic
971531225 4:27692151-27692173 TTTCCCTTTCCCATCGCCTTAGG + Intergenic
971959803 4:33471195-33471217 TACCCCTTTGCCATTGCCAGTGG - Intergenic
972903476 4:43714499-43714521 TCTCCCTTACCCAATGCCATGGG - Intergenic
976825792 4:89258849-89258871 TATCCTTTTCTCTATGGCATTGG + Intronic
977651062 4:99469876-99469898 CCTCCCTTTCCCAGTGGAATGGG - Intergenic
981709679 4:147696751-147696773 TATCCCTTTCCCTTTGGGGTTGG - Intergenic
982085516 4:151831827-151831849 TATAAATTTCCCATTTGCATTGG - Intergenic
989486829 5:42000274-42000296 TATCCCTTCCCCATGTTCATTGG - Intergenic
991135630 5:63178576-63178598 TATCTCTTTCCCATGAGGATTGG + Intergenic
995315532 5:110767683-110767705 TATCCCTATTTCATTTGCATTGG + Intergenic
995446110 5:112245971-112245993 TATCCCTTTCACAAAGGCCTCGG - Intronic
995522153 5:113018953-113018975 TATAGCTTTCACATTGGCTTGGG + Exonic
1000434896 5:161196291-161196313 TAACTCTTTCCCATAAGCATGGG - Intergenic
1000556982 5:162738006-162738028 TATCCCTATCTCTTTGCCATTGG - Intergenic
1000578086 5:163001174-163001196 TATCATTTTCCCTTTGTCATAGG + Intergenic
1003975418 6:11338587-11338609 CATTCCTTTCCCATTTGCAAAGG - Intronic
1006418476 6:33919108-33919130 TATCTCTTTCCTCTGGGCATGGG - Intergenic
1006902088 6:37509454-37509476 TATCCCCATCCCATTGACTTGGG - Intergenic
1007937735 6:45748279-45748301 TATCCCTCTCCCTTTGGGAGTGG - Intergenic
1018869514 6:167770412-167770434 TCTGCCTTTCCCAGTGGCCTGGG + Intergenic
1022637065 7:32146238-32146260 TATCCATTTCCCATTGCCACTGG + Intronic
1024086186 7:45893833-45893855 TTTCCACTTCCCAGTGGCATTGG + Intergenic
1024956567 7:54926996-54927018 TCTCCCTTTTCCATAGGCAGAGG - Intergenic
1025255383 7:57381196-57381218 TGTCCCTTTCCCATTGCCCCTGG - Intergenic
1030316159 7:108116504-108116526 TATCCCTTTCTTATTTGCAATGG + Intronic
1037418134 8:18673585-18673607 TTTCCCTTTGCCATTGTCCTGGG + Intronic
1040103226 8:43523303-43523325 TACCCTTTTCCCATTGGCCAGGG + Intergenic
1042207691 8:66345483-66345505 TATCCCTTTTCCAGTGTCCTTGG - Intergenic
1045425349 8:102060560-102060582 TATTCCTTTTCCATTGACAATGG + Intronic
1046154377 8:110268073-110268095 TCTCCCCTTCCCAGTGGCAAAGG + Intergenic
1046224406 8:111259379-111259401 TGTCCTTTTCCCATTGGCTGGGG + Intergenic
1047732659 8:127739061-127739083 GATACCTTTCCCATTTTCATTGG + Intronic
1053538229 9:38947047-38947069 TAACCCTGCCCCATGGGCATGGG - Intergenic
1053842357 9:42198971-42198993 TAGCCCTGTCACATAGGCATTGG + Intergenic
1054627905 9:67416872-67416894 TAACCCTGCCCCATGGGCATGGG + Intergenic
1058980470 9:110164863-110164885 TTTCCCTTTTCCATTTCCATGGG + Intronic
1059483946 9:114612644-114612666 TATCCCTTTCTGCTTGGCACTGG + Intronic
1060609682 9:124951538-124951560 TATCTCTTTCCCATGGCCCTAGG - Intronic
1060762806 9:126270405-126270427 TATCCCTTTACCATAGCCACAGG - Intergenic
1060808410 9:126593792-126593814 AATACCTATCCCATGGGCATGGG + Intergenic
1060919670 9:127411127-127411149 AATGCCTTCACCATTGGCATTGG + Intergenic
1203430078 Un_GL000195v1:82257-82279 TTTTCCTTTCTCCTTGGCATAGG - Intergenic
1186156282 X:6729909-6729931 TATCCTTTTCCCATTGGCTGGGG - Intergenic
1187384370 X:18833730-18833752 TTTCCCTTTCCTATTGGGACGGG - Intergenic
1189372357 X:40438928-40438950 TACCCTTTCCCCATTGGCTTGGG + Intergenic
1189779874 X:44503918-44503940 TAGCACTTTCCTATTGGCACAGG + Intergenic
1189889982 X:45591272-45591294 GACCCCTTTATCATTGGCATGGG + Intergenic
1193451772 X:81679556-81679578 TATACTTTTTCCTTTGGCATGGG + Intergenic
1193699996 X:84748511-84748533 AATCCCTTTCCTGTGGGCATTGG + Intergenic
1196047004 X:111267095-111267117 TCTCCCTTCCCCATCGCCATCGG - Intronic
1196886133 X:120247525-120247547 TATCCCTATCCAATTGACTTTGG + Intergenic
1199645808 X:149909636-149909658 TCTCCCTTTTCCATAGGCAGAGG - Intergenic
1199904746 X:152213660-152213682 TATCCCTTTCCCCATTACATTGG - Intronic