ID: 919551706 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:198998001-198998023 |
| Sequence | CATTTTGCACTACTGAAGGT TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 919551703_919551706 | 21 | Left | 919551703 | 1:198997957-198997979 | CCTAAATAAATATTTCATAAAGT | No data | ||
| Right | 919551706 | 1:198998001-198998023 | CATTTTGCACTACTGAAGGTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 919551706 | Original CRISPR | CATTTTGCACTACTGAAGGT TGG | Intergenic | ||
| No off target data available for this crispr | |||||