ID: 919551706

View in Genome Browser
Species Human (GRCh38)
Location 1:198998001-198998023
Sequence CATTTTGCACTACTGAAGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919551703_919551706 21 Left 919551703 1:198997957-198997979 CCTAAATAAATATTTCATAAAGT No data
Right 919551706 1:198998001-198998023 CATTTTGCACTACTGAAGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919551706 Original CRISPR CATTTTGCACTACTGAAGGT TGG Intergenic
No off target data available for this crispr