ID: 919559005

View in Genome Browser
Species Human (GRCh38)
Location 1:199095008-199095030
Sequence TCTAGTAGATTGGGAACCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919558998_919559005 21 Left 919558998 1:199094964-199094986 CCCCTGTGTACTCTTATCAAGGA No data
Right 919559005 1:199095008-199095030 TCTAGTAGATTGGGAACCAGAGG No data
919558999_919559005 20 Left 919558999 1:199094965-199094987 CCCTGTGTACTCTTATCAAGGAG No data
Right 919559005 1:199095008-199095030 TCTAGTAGATTGGGAACCAGAGG No data
919559000_919559005 19 Left 919559000 1:199094966-199094988 CCTGTGTACTCTTATCAAGGAGA No data
Right 919559005 1:199095008-199095030 TCTAGTAGATTGGGAACCAGAGG No data
919559002_919559005 -5 Left 919559002 1:199094990-199095012 CCAGAGAGCAAATACTCATCTAG No data
Right 919559005 1:199095008-199095030 TCTAGTAGATTGGGAACCAGAGG No data
919559001_919559005 -4 Left 919559001 1:199094989-199095011 CCCAGAGAGCAAATACTCATCTA No data
Right 919559005 1:199095008-199095030 TCTAGTAGATTGGGAACCAGAGG No data
919558996_919559005 26 Left 919558996 1:199094959-199094981 CCAGGCCCCTGTGTACTCTTATC No data
Right 919559005 1:199095008-199095030 TCTAGTAGATTGGGAACCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919559005 Original CRISPR TCTAGTAGATTGGGAACCAG AGG Intergenic