ID: 919572423

View in Genome Browser
Species Human (GRCh38)
Location 1:199265537-199265559
Sequence GGATGGTCACTGTACATATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919572423_919572429 20 Left 919572423 1:199265537-199265559 CCTCATATGTACAGTGACCATCC No data
Right 919572429 1:199265580-199265602 GGCCCCACGGGTACACAAGCAGG No data
919572423_919572434 26 Left 919572423 1:199265537-199265559 CCTCATATGTACAGTGACCATCC No data
Right 919572434 1:199265586-199265608 ACGGGTACACAAGCAGGGAGAGG No data
919572423_919572426 -1 Left 919572423 1:199265537-199265559 CCTCATATGTACAGTGACCATCC No data
Right 919572426 1:199265559-199265581 CAGATCTCTGCAGTGTTAAGAGG No data
919572423_919572430 21 Left 919572423 1:199265537-199265559 CCTCATATGTACAGTGACCATCC No data
Right 919572430 1:199265581-199265603 GCCCCACGGGTACACAAGCAGGG No data
919572423_919572428 8 Left 919572423 1:199265537-199265559 CCTCATATGTACAGTGACCATCC No data
Right 919572428 1:199265568-199265590 GCAGTGTTAAGAGGCCCCACGGG No data
919572423_919572427 7 Left 919572423 1:199265537-199265559 CCTCATATGTACAGTGACCATCC No data
Right 919572427 1:199265567-199265589 TGCAGTGTTAAGAGGCCCCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919572423 Original CRISPR GGATGGTCACTGTACATATG AGG (reversed) Intergenic
No off target data available for this crispr