ID: 919572424

View in Genome Browser
Species Human (GRCh38)
Location 1:199265554-199265576
Sequence TAACACTGCAGAGATCTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919572424_919572428 -9 Left 919572424 1:199265554-199265576 CCATCCAGATCTCTGCAGTGTTA No data
Right 919572428 1:199265568-199265590 GCAGTGTTAAGAGGCCCCACGGG No data
919572424_919572427 -10 Left 919572424 1:199265554-199265576 CCATCCAGATCTCTGCAGTGTTA No data
Right 919572427 1:199265567-199265589 TGCAGTGTTAAGAGGCCCCACGG No data
919572424_919572429 3 Left 919572424 1:199265554-199265576 CCATCCAGATCTCTGCAGTGTTA No data
Right 919572429 1:199265580-199265602 GGCCCCACGGGTACACAAGCAGG No data
919572424_919572434 9 Left 919572424 1:199265554-199265576 CCATCCAGATCTCTGCAGTGTTA No data
Right 919572434 1:199265586-199265608 ACGGGTACACAAGCAGGGAGAGG No data
919572424_919572430 4 Left 919572424 1:199265554-199265576 CCATCCAGATCTCTGCAGTGTTA No data
Right 919572430 1:199265581-199265603 GCCCCACGGGTACACAAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919572424 Original CRISPR TAACACTGCAGAGATCTGGA TGG (reversed) Intergenic
No off target data available for this crispr