ID: 919572425

View in Genome Browser
Species Human (GRCh38)
Location 1:199265558-199265580
Sequence CTCTTAACACTGCAGAGATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919572425_919572429 -1 Left 919572425 1:199265558-199265580 CCAGATCTCTGCAGTGTTAAGAG No data
Right 919572429 1:199265580-199265602 GGCCCCACGGGTACACAAGCAGG No data
919572425_919572430 0 Left 919572425 1:199265558-199265580 CCAGATCTCTGCAGTGTTAAGAG No data
Right 919572430 1:199265581-199265603 GCCCCACGGGTACACAAGCAGGG No data
919572425_919572434 5 Left 919572425 1:199265558-199265580 CCAGATCTCTGCAGTGTTAAGAG No data
Right 919572434 1:199265586-199265608 ACGGGTACACAAGCAGGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919572425 Original CRISPR CTCTTAACACTGCAGAGATC TGG (reversed) Intergenic
No off target data available for this crispr