ID: 919572429

View in Genome Browser
Species Human (GRCh38)
Location 1:199265580-199265602
Sequence GGCCCCACGGGTACACAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919572424_919572429 3 Left 919572424 1:199265554-199265576 CCATCCAGATCTCTGCAGTGTTA No data
Right 919572429 1:199265580-199265602 GGCCCCACGGGTACACAAGCAGG No data
919572423_919572429 20 Left 919572423 1:199265537-199265559 CCTCATATGTACAGTGACCATCC No data
Right 919572429 1:199265580-199265602 GGCCCCACGGGTACACAAGCAGG No data
919572425_919572429 -1 Left 919572425 1:199265558-199265580 CCAGATCTCTGCAGTGTTAAGAG No data
Right 919572429 1:199265580-199265602 GGCCCCACGGGTACACAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919572429 Original CRISPR GGCCCCACGGGTACACAAGC AGG Intergenic
No off target data available for this crispr