ID: 919578682

View in Genome Browser
Species Human (GRCh38)
Location 1:199343386-199343408
Sequence CAATGCACTCCCTGTGTCTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919578678_919578682 30 Left 919578678 1:199343333-199343355 CCATTGGGAAAATGGGAAAACTT No data
Right 919578682 1:199343386-199343408 CAATGCACTCCCTGTGTCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919578682 Original CRISPR CAATGCACTCCCTGTGTCTT AGG Intergenic
No off target data available for this crispr