ID: 919581311

View in Genome Browser
Species Human (GRCh38)
Location 1:199377493-199377515
Sequence GCATTTACATGACTGTACTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919581308_919581311 29 Left 919581308 1:199377441-199377463 CCATGGGGAGATTTTTGAGGTAT No data
Right 919581311 1:199377493-199377515 GCATTTACATGACTGTACTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919581311 Original CRISPR GCATTTACATGACTGTACTG TGG Intergenic
No off target data available for this crispr