ID: 919582963

View in Genome Browser
Species Human (GRCh38)
Location 1:199400350-199400372
Sequence ACTCATTCTCTGAAGGTAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919582963_919582968 29 Left 919582963 1:199400350-199400372 CCATCTACCTTCAGAGAATGAGT No data
Right 919582968 1:199400402-199400424 AACCTCCACTGTTTCGTTCCAGG No data
919582963_919582969 30 Left 919582963 1:199400350-199400372 CCATCTACCTTCAGAGAATGAGT No data
Right 919582969 1:199400403-199400425 ACCTCCACTGTTTCGTTCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919582963 Original CRISPR ACTCATTCTCTGAAGGTAGA TGG (reversed) Intergenic
No off target data available for this crispr