ID: 919586625

View in Genome Browser
Species Human (GRCh38)
Location 1:199447897-199447919
Sequence GCAGTCTGCAGCATCACTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919586625_919586626 -6 Left 919586625 1:199447897-199447919 CCTGAAGTGATGCTGCAGACTGC No data
Right 919586626 1:199447914-199447936 GACTGCAACAGCCAGTGTATTGG No data
919586625_919586631 15 Left 919586625 1:199447897-199447919 CCTGAAGTGATGCTGCAGACTGC No data
Right 919586631 1:199447935-199447957 GGGCTGTGAGGACAAATCTTGGG No data
919586625_919586627 -5 Left 919586625 1:199447897-199447919 CCTGAAGTGATGCTGCAGACTGC No data
Right 919586627 1:199447915-199447937 ACTGCAACAGCCAGTGTATTGGG No data
919586625_919586630 14 Left 919586625 1:199447897-199447919 CCTGAAGTGATGCTGCAGACTGC No data
Right 919586630 1:199447934-199447956 TGGGCTGTGAGGACAAATCTTGG No data
919586625_919586628 3 Left 919586625 1:199447897-199447919 CCTGAAGTGATGCTGCAGACTGC No data
Right 919586628 1:199447923-199447945 AGCCAGTGTATTGGGCTGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919586625 Original CRISPR GCAGTCTGCAGCATCACTTC AGG (reversed) Intergenic
No off target data available for this crispr