ID: 919590631

View in Genome Browser
Species Human (GRCh38)
Location 1:199497779-199497801
Sequence CAGAAAAAGAAGAACTAGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919590626_919590631 18 Left 919590626 1:199497738-199497760 CCAGGAAAAAAAAAACAAAAACT No data
Right 919590631 1:199497779-199497801 CAGAAAAAGAAGAACTAGGCCGG No data
919590629_919590631 -10 Left 919590629 1:199497766-199497788 CCGGATAGATTCACAGAAAAAGA No data
Right 919590631 1:199497779-199497801 CAGAAAAAGAAGAACTAGGCCGG No data
919590625_919590631 19 Left 919590625 1:199497737-199497759 CCCAGGAAAAAAAAAACAAAAAC No data
Right 919590631 1:199497779-199497801 CAGAAAAAGAAGAACTAGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919590631 Original CRISPR CAGAAAAAGAAGAACTAGGC CGG Intergenic
No off target data available for this crispr