ID: 919592571

View in Genome Browser
Species Human (GRCh38)
Location 1:199522920-199522942
Sequence ATTCCTTCTAGTATCTATAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919592564_919592571 28 Left 919592564 1:199522869-199522891 CCATGCCAGACTGAGTCCAGTCC No data
Right 919592571 1:199522920-199522942 ATTCCTTCTAGTATCTATATGGG No data
919592568_919592571 7 Left 919592568 1:199522890-199522912 CCTTGGCAAGATGACCAAATGTA No data
Right 919592571 1:199522920-199522942 ATTCCTTCTAGTATCTATATGGG No data
919592567_919592571 12 Left 919592567 1:199522885-199522907 CCAGTCCTTGGCAAGATGACCAA No data
Right 919592571 1:199522920-199522942 ATTCCTTCTAGTATCTATATGGG No data
919592569_919592571 -7 Left 919592569 1:199522904-199522926 CCAAATGTATGCTTTTATTCCTT No data
Right 919592571 1:199522920-199522942 ATTCCTTCTAGTATCTATATGGG No data
919592566_919592571 23 Left 919592566 1:199522874-199522896 CCAGACTGAGTCCAGTCCTTGGC No data
Right 919592571 1:199522920-199522942 ATTCCTTCTAGTATCTATATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919592571 Original CRISPR ATTCCTTCTAGTATCTATAT GGG Intergenic
No off target data available for this crispr