ID: 919594655

View in Genome Browser
Species Human (GRCh38)
Location 1:199546827-199546849
Sequence CCAGAGCCGGCACTATCTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919594648_919594655 16 Left 919594648 1:199546788-199546810 CCTCTACTGGCTATGGTATTGCC No data
Right 919594655 1:199546827-199546849 CCAGAGCCGGCACTATCTTGGGG No data
919594649_919594655 -5 Left 919594649 1:199546809-199546831 CCCTTTTTGCTCACAAAGCCAGA No data
Right 919594655 1:199546827-199546849 CCAGAGCCGGCACTATCTTGGGG No data
919594650_919594655 -6 Left 919594650 1:199546810-199546832 CCTTTTTGCTCACAAAGCCAGAG No data
Right 919594655 1:199546827-199546849 CCAGAGCCGGCACTATCTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919594655 Original CRISPR CCAGAGCCGGCACTATCTTG GGG Intergenic
No off target data available for this crispr