ID: 919596880

View in Genome Browser
Species Human (GRCh38)
Location 1:199575333-199575355
Sequence CATCAACCACAATTGTAGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919596880_919596884 25 Left 919596880 1:199575333-199575355 CCAACCTACAATTGTGGTTGATG No data
Right 919596884 1:199575381-199575403 AAAAATGTAAACGTTTGGTAAGG No data
919596880_919596883 20 Left 919596880 1:199575333-199575355 CCAACCTACAATTGTGGTTGATG No data
Right 919596883 1:199575376-199575398 GTAGAAAAAATGTAAACGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919596880 Original CRISPR CATCAACCACAATTGTAGGT TGG (reversed) Intergenic
No off target data available for this crispr