ID: 919598108

View in Genome Browser
Species Human (GRCh38)
Location 1:199589798-199589820
Sequence ATGAAGAAACAGTCTAGTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919598108_919598113 29 Left 919598108 1:199589798-199589820 CCTTTACTAGACTGTTTCTTCAT No data
Right 919598113 1:199589850-199589872 TTATGTTCCAGAATTGTTCTGGG No data
919598108_919598112 28 Left 919598108 1:199589798-199589820 CCTTTACTAGACTGTTTCTTCAT No data
Right 919598112 1:199589849-199589871 ATTATGTTCCAGAATTGTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919598108 Original CRISPR ATGAAGAAACAGTCTAGTAA AGG (reversed) Intergenic
No off target data available for this crispr