ID: 919599958

View in Genome Browser
Species Human (GRCh38)
Location 1:199610417-199610439
Sequence CTGAGTGAATAAAAGGAGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919599958_919599961 -8 Left 919599958 1:199610417-199610439 CCTACCTCCTTTTATTCACTCAG No data
Right 919599961 1:199610432-199610454 TCACTCAGTTTCAGCCACTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919599958 Original CRISPR CTGAGTGAATAAAAGGAGGT AGG (reversed) Intergenic
No off target data available for this crispr