ID: 919599961

View in Genome Browser
Species Human (GRCh38)
Location 1:199610432-199610454
Sequence TCACTCAGTTTCAGCCACTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919599954_919599961 7 Left 919599954 1:199610402-199610424 CCTTTGACTTCCCCTCCTACCTC No data
Right 919599961 1:199610432-199610454 TCACTCAGTTTCAGCCACTGTGG No data
919599949_919599961 17 Left 919599949 1:199610392-199610414 CCCCATGACCCCTTTGACTTCCC No data
Right 919599961 1:199610432-199610454 TCACTCAGTTTCAGCCACTGTGG No data
919599950_919599961 16 Left 919599950 1:199610393-199610415 CCCATGACCCCTTTGACTTCCCC No data
Right 919599961 1:199610432-199610454 TCACTCAGTTTCAGCCACTGTGG No data
919599956_919599961 -4 Left 919599956 1:199610413-199610435 CCCTCCTACCTCCTTTTATTCAC No data
Right 919599961 1:199610432-199610454 TCACTCAGTTTCAGCCACTGTGG No data
919599952_919599961 9 Left 919599952 1:199610400-199610422 CCCCTTTGACTTCCCCTCCTACC No data
Right 919599961 1:199610432-199610454 TCACTCAGTTTCAGCCACTGTGG No data
919599951_919599961 15 Left 919599951 1:199610394-199610416 CCATGACCCCTTTGACTTCCCCT No data
Right 919599961 1:199610432-199610454 TCACTCAGTTTCAGCCACTGTGG No data
919599958_919599961 -8 Left 919599958 1:199610417-199610439 CCTACCTCCTTTTATTCACTCAG No data
Right 919599961 1:199610432-199610454 TCACTCAGTTTCAGCCACTGTGG No data
919599955_919599961 -3 Left 919599955 1:199610412-199610434 CCCCTCCTACCTCCTTTTATTCA No data
Right 919599961 1:199610432-199610454 TCACTCAGTTTCAGCCACTGTGG No data
919599957_919599961 -5 Left 919599957 1:199610414-199610436 CCTCCTACCTCCTTTTATTCACT No data
Right 919599961 1:199610432-199610454 TCACTCAGTTTCAGCCACTGTGG No data
919599953_919599961 8 Left 919599953 1:199610401-199610423 CCCTTTGACTTCCCCTCCTACCT No data
Right 919599961 1:199610432-199610454 TCACTCAGTTTCAGCCACTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919599961 Original CRISPR TCACTCAGTTTCAGCCACTG TGG Intergenic
No off target data available for this crispr