ID: 919603954

View in Genome Browser
Species Human (GRCh38)
Location 1:199657102-199657124
Sequence ATGGTGTTCTTAAAGATAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919603954_919603957 30 Left 919603954 1:199657102-199657124 CCTTTTATCTTTAAGAACACCAT No data
Right 919603957 1:199657155-199657177 ATTCTTGACTTTCAAATGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919603954 Original CRISPR ATGGTGTTCTTAAAGATAAA AGG (reversed) Intergenic
No off target data available for this crispr