ID: 919610000

View in Genome Browser
Species Human (GRCh38)
Location 1:199733445-199733467
Sequence CCATGTAAGCAGATTTTCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919610000_919610006 -1 Left 919610000 1:199733445-199733467 CCCTGGAAAATCTGCTTACATGG No data
Right 919610006 1:199733467-199733489 GTTAGGGCTAGTGAAAACAAGGG No data
919610000_919610007 28 Left 919610000 1:199733445-199733467 CCCTGGAAAATCTGCTTACATGG No data
Right 919610007 1:199733496-199733518 AATGTAAAAGATCATGTAATCGG No data
919610000_919610005 -2 Left 919610000 1:199733445-199733467 CCCTGGAAAATCTGCTTACATGG No data
Right 919610005 1:199733466-199733488 GGTTAGGGCTAGTGAAAACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919610000 Original CRISPR CCATGTAAGCAGATTTTCCA GGG (reversed) Intergenic
No off target data available for this crispr