ID: 919611120

View in Genome Browser
Species Human (GRCh38)
Location 1:199747071-199747093
Sequence CAGAACAATTAGGTAGAATC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919611116_919611120 26 Left 919611116 1:199747022-199747044 CCCTCTGAATTTCAGAGCACACA No data
Right 919611120 1:199747071-199747093 CAGAACAATTAGGTAGAATCAGG No data
919611117_919611120 25 Left 919611117 1:199747023-199747045 CCTCTGAATTTCAGAGCACACAG No data
Right 919611120 1:199747071-199747093 CAGAACAATTAGGTAGAATCAGG No data
919611118_919611120 -4 Left 919611118 1:199747052-199747074 CCTTCACATAGTACTGCATCAGA No data
Right 919611120 1:199747071-199747093 CAGAACAATTAGGTAGAATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919611120 Original CRISPR CAGAACAATTAGGTAGAATC AGG Intergenic
No off target data available for this crispr