ID: 919612045

View in Genome Browser
Species Human (GRCh38)
Location 1:199757641-199757663
Sequence CATCATTTCAAGATGGCACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919612042_919612045 -1 Left 919612042 1:199757619-199757641 CCAAATGGACCATGCTTCTCAGC No data
Right 919612045 1:199757641-199757663 CATCATTTCAAGATGGCACAAGG No data
919612043_919612045 -10 Left 919612043 1:199757628-199757650 CCATGCTTCTCAGCATCATTTCA No data
Right 919612045 1:199757641-199757663 CATCATTTCAAGATGGCACAAGG No data
919612041_919612045 10 Left 919612041 1:199757608-199757630 CCACATGGTGACCAAATGGACCA No data
Right 919612045 1:199757641-199757663 CATCATTTCAAGATGGCACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919612045 Original CRISPR CATCATTTCAAGATGGCACA AGG Intergenic
No off target data available for this crispr