ID: 919612370 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:199760936-199760958 |
| Sequence | CAGTATCTGTATTTGAATTC TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 919612370_919612372 | -4 | Left | 919612370 | 1:199760936-199760958 | CCAGAATTCAAATACAGATACTG | No data | ||
| Right | 919612372 | 1:199760955-199760977 | ACTGTCACTTTTTCATTAAAGGG | No data | ||||
| 919612370_919612371 | -5 | Left | 919612370 | 1:199760936-199760958 | CCAGAATTCAAATACAGATACTG | No data | ||
| Right | 919612371 | 1:199760954-199760976 | TACTGTCACTTTTTCATTAAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 919612370 | Original CRISPR | CAGTATCTGTATTTGAATTC TGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||