ID: 919612370

View in Genome Browser
Species Human (GRCh38)
Location 1:199760936-199760958
Sequence CAGTATCTGTATTTGAATTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919612370_919612372 -4 Left 919612370 1:199760936-199760958 CCAGAATTCAAATACAGATACTG No data
Right 919612372 1:199760955-199760977 ACTGTCACTTTTTCATTAAAGGG No data
919612370_919612371 -5 Left 919612370 1:199760936-199760958 CCAGAATTCAAATACAGATACTG No data
Right 919612371 1:199760954-199760976 TACTGTCACTTTTTCATTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919612370 Original CRISPR CAGTATCTGTATTTGAATTC TGG (reversed) Intergenic
No off target data available for this crispr