ID: 919616007

View in Genome Browser
Species Human (GRCh38)
Location 1:199809872-199809894
Sequence CTGGGACTACCTGCTTTTAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919616003_919616007 22 Left 919616003 1:199809827-199809849 CCGATTAAAGAATAATGGGAAAA No data
Right 919616007 1:199809872-199809894 CTGGGACTACCTGCTTTTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919616007 Original CRISPR CTGGGACTACCTGCTTTTAA TGG Intergenic
No off target data available for this crispr