ID: 919616158

View in Genome Browser
Species Human (GRCh38)
Location 1:199811355-199811377
Sequence CAATCCCTCCTCTCCATGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919616154_919616158 8 Left 919616154 1:199811324-199811346 CCATTCTCCACAACTGGTCTTTC No data
Right 919616158 1:199811355-199811377 CAATCCCTCCTCTCCATGGCTGG No data
919616151_919616158 18 Left 919616151 1:199811314-199811336 CCGGAAGCCTCCATTCTCCACAA No data
Right 919616158 1:199811355-199811377 CAATCCCTCCTCTCCATGGCTGG No data
919616153_919616158 11 Left 919616153 1:199811321-199811343 CCTCCATTCTCCACAACTGGTCT No data
Right 919616158 1:199811355-199811377 CAATCCCTCCTCTCCATGGCTGG No data
919616155_919616158 1 Left 919616155 1:199811331-199811353 CCACAACTGGTCTTTCTGCCTTT No data
Right 919616158 1:199811355-199811377 CAATCCCTCCTCTCCATGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919616158 Original CRISPR CAATCCCTCCTCTCCATGGC TGG Intergenic
No off target data available for this crispr