ID: 919620826

View in Genome Browser
Species Human (GRCh38)
Location 1:199862846-199862868
Sequence GGGACCTGGCCATTCTGCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919620826_919620832 6 Left 919620826 1:199862846-199862868 CCACAGCAGAATGGCCAGGTCCC No data
Right 919620832 1:199862875-199862897 TACAGTGCACTAGGAAACCGAGG No data
919620826_919620833 11 Left 919620826 1:199862846-199862868 CCACAGCAGAATGGCCAGGTCCC No data
Right 919620833 1:199862880-199862902 TGCACTAGGAAACCGAGGCATGG No data
919620826_919620834 16 Left 919620826 1:199862846-199862868 CCACAGCAGAATGGCCAGGTCCC No data
Right 919620834 1:199862885-199862907 TAGGAAACCGAGGCATGGTGTGG No data
919620826_919620829 -3 Left 919620826 1:199862846-199862868 CCACAGCAGAATGGCCAGGTCCC No data
Right 919620829 1:199862866-199862888 CCCTATGCCTACAGTGCACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919620826 Original CRISPR GGGACCTGGCCATTCTGCTG TGG (reversed) Intergenic
No off target data available for this crispr