ID: 919622324

View in Genome Browser
Species Human (GRCh38)
Location 1:199876758-199876780
Sequence ATCGAGAAGGAAAATGAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919622320_919622324 5 Left 919622320 1:199876730-199876752 CCCTTGATTTCACGGGTTACCAG No data
Right 919622324 1:199876758-199876780 ATCGAGAAGGAAAATGAGCAAGG No data
919622321_919622324 4 Left 919622321 1:199876731-199876753 CCTTGATTTCACGGGTTACCAGA No data
Right 919622324 1:199876758-199876780 ATCGAGAAGGAAAATGAGCAAGG No data
919622317_919622324 20 Left 919622317 1:199876715-199876737 CCATGGGCTTGAGAACCCTTGAT No data
Right 919622324 1:199876758-199876780 ATCGAGAAGGAAAATGAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919622324 Original CRISPR ATCGAGAAGGAAAATGAGCA AGG Intergenic
No off target data available for this crispr