ID: 919626976

View in Genome Browser
Species Human (GRCh38)
Location 1:199920676-199920698
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 9283
Summary {0: 13, 1: 220, 2: 1105, 3: 2524, 4: 5421}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919626976 Original CRISPR GAGGGTGAAGGGTAGGAGGA GGG (reversed) Intergenic
Too many off-targets to display for this crispr