ID: 919628671

View in Genome Browser
Species Human (GRCh38)
Location 1:199937779-199937801
Sequence GAAAGTGGTCAGATGCAGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919628671_919628674 2 Left 919628671 1:199937779-199937801 CCAACCTGCATCTGACCACTTTC No data
Right 919628674 1:199937804-199937826 TCTAGAAACCTCATTCTCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919628671 Original CRISPR GAAAGTGGTCAGATGCAGGT TGG (reversed) Intergenic
No off target data available for this crispr