ID: 919638743

View in Genome Browser
Species Human (GRCh38)
Location 1:200029429-200029451
Sequence CTGGAAACACAGTTCTTCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 316
Summary {0: 1, 1: 0, 2: 9, 3: 24, 4: 282}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919638743_919638748 7 Left 919638743 1:200029429-200029451 CCCTGGAAGAACTGTGTTTCCAG 0: 1
1: 0
2: 9
3: 24
4: 282
Right 919638748 1:200029459-200029481 ACGCGCAACTCACATCGCAAGGG 0: 1
1: 0
2: 0
3: 1
4: 13
919638743_919638749 14 Left 919638743 1:200029429-200029451 CCCTGGAAGAACTGTGTTTCCAG 0: 1
1: 0
2: 9
3: 24
4: 282
Right 919638749 1:200029466-200029488 ACTCACATCGCAAGGGACCGAGG 0: 1
1: 0
2: 0
3: 6
4: 138
919638743_919638747 6 Left 919638743 1:200029429-200029451 CCCTGGAAGAACTGTGTTTCCAG 0: 1
1: 0
2: 9
3: 24
4: 282
Right 919638747 1:200029458-200029480 CACGCGCAACTCACATCGCAAGG 0: 1
1: 0
2: 0
3: 1
4: 29
919638743_919638750 17 Left 919638743 1:200029429-200029451 CCCTGGAAGAACTGTGTTTCCAG 0: 1
1: 0
2: 9
3: 24
4: 282
Right 919638750 1:200029469-200029491 CACATCGCAAGGGACCGAGGCGG 0: 1
1: 0
2: 0
3: 4
4: 70

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919638743 Original CRISPR CTGGAAACACAGTTCTTCCA GGG (reversed) Intronic
900126879 1:1072665-1072687 CAGGAAACAGAGTCCTTCCCTGG - Intronic
900800276 1:4732895-4732917 TTGGAGACGCAGTTCCTCCAAGG - Intronic
900960813 1:5918180-5918202 CTGAAAACAAAGCTCTGCCATGG + Intronic
901367771 1:8768297-8768319 CTGGAAAGAATGTTTTTCCATGG - Intronic
901744336 1:11362654-11362676 CTGGACACACATCTCTGCCACGG + Intergenic
902065835 1:13685727-13685749 CAGAAAACGCAGTTCTGCCAAGG - Intergenic
902129200 1:14244186-14244208 CAGGAAACACAGGTGTCCCAAGG - Intergenic
902133152 1:14281213-14281235 TGGCAAATACAGTTCTTCCAGGG - Intergenic
903007934 1:20310719-20310741 CTGGAAGCCCAGCCCTTCCAGGG + Exonic
904527872 1:31147780-31147802 CTGGAAACATAGTCCTTCTGAGG - Intergenic
906090782 1:43177628-43177650 CATGAAAAACAGTTTTTCCATGG + Intronic
907222720 1:52919147-52919169 CATGAAAGACAGTTTTTCCATGG - Intronic
910807347 1:91202122-91202144 CTGGAAGCAAAGTGCTGCCAGGG + Intergenic
910899992 1:92110076-92110098 CTCATAACACAGGTCTTCCAAGG + Intronic
911907653 1:103589893-103589915 ATGGACACAAATTTCTTCCAAGG - Intergenic
912756189 1:112326466-112326488 CTGGATGCACAGTTCTGCCCTGG + Intergenic
913312462 1:117514860-117514882 CTGGAAAAACAGTTCTCTCATGG - Intronic
917757403 1:178116011-178116033 CTGGAAGCATTTTTCTTCCAGGG + Intronic
918041336 1:180915950-180915972 CATGAAAGACAGTTTTTCCATGG - Intronic
918323988 1:183392232-183392254 ATGGAAACTCCATTCTTCCAAGG + Intronic
918699441 1:187589481-187589503 CGTGGAACACAGTTTTTCCATGG - Intergenic
919638743 1:200029429-200029451 CTGGAAACACAGTTCTTCCAGGG - Intronic
921632373 1:217451248-217451270 CTGAAAGCATAGTTTTTCCATGG - Intronic
921681327 1:218035804-218035826 CTCAAAAAACAGTTTTTCCAAGG - Intergenic
921901286 1:220453621-220453643 CTTGGAACACCATTCTTCCAGGG - Intergenic
922661586 1:227435061-227435083 CAGGAGACACAGTTCTTACCAGG + Intergenic
923333051 1:232943539-232943561 CAGGATACTCAGTTTTTCCAAGG + Intergenic
924767185 1:247045030-247045052 CTGGGAACTCAGTTCTTTAATGG - Intronic
1063354825 10:5388211-5388233 TTGAAAAAACAGTTTTTCCAGGG + Intergenic
1065307343 10:24381627-24381649 CATGAAAGACAGTTTTTCCATGG - Intronic
1065993211 10:31032341-31032363 CTGAAAAGACAGCTCTCCCAGGG + Intergenic
1067061124 10:43078393-43078415 CTGGAAACTCAGTTTGTGCAGGG - Intronic
1067297915 10:44985286-44985308 CTGGATACACAGTGTTCCCAGGG - Intronic
1067750318 10:48967424-48967446 ATTGAGAAACAGTTCTTCCAGGG + Intronic
1068124425 10:52821261-52821283 CTGAACACAAAGTTGTTCCAAGG - Intergenic
1068875606 10:61992644-61992666 ATGGAAACACAGATCTTCCCAGG - Intronic
1070787411 10:79170016-79170038 ATGGAGACACAGTGCTTCCCAGG + Intronic
1071003103 10:80853488-80853510 CTGGAAATTGAGTTCTTCAAGGG + Intergenic
1071317407 10:84415801-84415823 CTGGAAACTCAGTCCTTCTCAGG + Intronic
1072218648 10:93309151-93309173 CTGCTAAGACAGTTCCTCCAAGG - Intronic
1072484450 10:95841761-95841783 CTGGAAAAACAGTTTTGCTAGGG + Intronic
1073303669 10:102486324-102486346 CTTGGAAGACAGTTTTTCCATGG - Intronic
1073632924 10:105166668-105166690 ATTGAAACACAGTACTTCCAGGG - Intronic
1073699251 10:105907067-105907089 CATGAAAGACAGTTTTTCCAAGG - Intergenic
1073842607 10:107515138-107515160 TTGAAATCTCAGTTCTTCCAAGG + Intergenic
1074037728 10:109757598-109757620 ATAAAAACATAGTTCTTCCAGGG - Intergenic
1074422784 10:113324081-113324103 CTTGAAACGCAGCTCTTCCCTGG - Intergenic
1074458112 10:113613025-113613047 CTTTAAACACAGCTCCTCCAAGG - Intronic
1075449067 10:122535257-122535279 CTTGAGCCACAGTTCTTCCAGGG + Intergenic
1075616882 10:123896790-123896812 CAAGAAACACAGTGCCTCCAAGG - Intronic
1076250189 10:128979042-128979064 ATGGAAAGACAGTTTTTCCTGGG - Intergenic
1076430330 10:130397564-130397586 CTTGAAACACATTTCTTACGTGG - Intergenic
1077739182 11:4826249-4826271 CTGGAAAGACTGTTCTTTCTAGG + Intronic
1086242796 11:84716208-84716230 CTGGATAGACACTTCTTCAAAGG - Intronic
1086390789 11:86360685-86360707 CTGAAAACACAGTTCTGGCCAGG - Intergenic
1089339324 11:117746847-117746869 CTGAAATCTCAGGTCTTCCATGG + Intronic
1091060609 11:132457938-132457960 CTGGAATCTAAGCTCTTCCACGG - Intronic
1094058255 12:26287632-26287654 TTGGAACCACAGCTCCTCCATGG + Intronic
1097218802 12:57434776-57434798 CTGGACACACACTTCTTCCAGGG + Exonic
1097751601 12:63360438-63360460 TTGGACACACATTTGTTCCATGG - Intergenic
1097961679 12:65537513-65537535 CTGGAAACTCCCTACTTCCAGGG - Intergenic
1098157586 12:67615494-67615516 CTGAAAACACTGATTTTCCAAGG + Intergenic
1098185013 12:67887273-67887295 CTGGGAACACAGTTCATCTGAGG + Intergenic
1098217631 12:68236872-68236894 CTGGAAACGCAGTTCTTGATGGG - Intergenic
1098913738 12:76236300-76236322 CTGAAAACACATTGCTTCCAAGG + Intergenic
1100367626 12:93936164-93936186 CAGGAAACACACATTTTCCAGGG + Intergenic
1100689474 12:97024518-97024540 CTGGGAACACAATTTTACCAGGG - Intergenic
1104099442 12:125592475-125592497 TTGGAAACAAAGTCCTTCCCTGG - Intronic
1104449415 12:128857088-128857110 CTGTAAACCCACATCTTCCAAGG + Intronic
1104688067 12:130802818-130802840 CCTGTAACACAGTTTTTCCAAGG - Intronic
1105522674 13:21144779-21144801 CTGGAAAGACAGTCCTTAGAAGG + Intronic
1107112100 13:36709109-36709131 CTGGAAAAGCAGTACTTCAAAGG - Intergenic
1107609677 13:42100463-42100485 CGTGAAAGACAGTTTTTCCATGG - Intronic
1108545853 13:51492497-51492519 CTTGAAACATATTTCTGCCATGG - Intergenic
1109089553 13:58023279-58023301 CTGAAATCTCAATTCTTCCATGG - Intergenic
1112334774 13:98505168-98505190 CCGGAAACACAGATCCACCAAGG + Intronic
1112603374 13:100879210-100879232 CTGGAAACACTGTTTGTCCCTGG + Intergenic
1114127618 14:19748103-19748125 CTGAGAACACACTTCTGCCAGGG + Exonic
1114376887 14:22156183-22156205 GTGGAGACACAGTGCTTCCCAGG + Intergenic
1114676071 14:24441098-24441120 CTGCAACCAGAGTTCCTCCAGGG - Exonic
1115883888 14:37949995-37950017 CTGCAAACTCAGTTTTTTCATGG + Intronic
1117292392 14:54346242-54346264 CAGGAAACCAAGTTCTTCCAAGG + Intergenic
1117519993 14:56541955-56541977 TTGGGAACAGAGCTCTTCCAGGG - Intronic
1118806179 14:69238883-69238905 CTGTAATCCCAGTTCTTCCAAGG - Intronic
1119244581 14:73093159-73093181 CTGGAAAAACAGTTATTCTCTGG + Intronic
1125545631 15:40502167-40502189 CTGGAAAGACAGTTCCTGGATGG + Intergenic
1125936884 15:43644751-43644773 CTTGCAAGACAGTTTTTCCATGG - Intronic
1125949692 15:43741538-43741560 CTTGGAAGACAGTTTTTCCATGG - Intergenic
1127475552 15:59329189-59329211 CTGGGAAGACAGCTCCTCCATGG + Intronic
1127581363 15:60341894-60341916 CTGGAAACCCAGCTCTCCCAGGG + Intergenic
1128150360 15:65359635-65359657 CCTGAAACACCCTTCTTCCAAGG - Intronic
1129061689 15:72865482-72865504 CCCGATAGACAGTTCTTCCAAGG + Intergenic
1129952766 15:79606788-79606810 TTGGAAACACACACCTTCCATGG - Intergenic
1130514913 15:84618930-84618952 CAGTAAACACAGTTCTGCCGGGG + Intronic
1131309363 15:91274237-91274259 CTGGAAACATTGTTCTCCAAAGG + Intronic
1131399102 15:92110405-92110427 ATGGAGACAAAGTCCTTCCATGG + Intronic
1131492978 15:92878970-92878992 CAGGAAACTCAGTACCTCCAGGG - Intergenic
1132786195 16:1658192-1658214 GAGGAAAGAAAGTTCTTCCAGGG + Intronic
1134057577 16:11180245-11180267 AAGGAAACACAGTCCTGCCAAGG + Exonic
1134216610 16:12321413-12321435 CTGGAATCACAGTGATTCCCAGG + Intronic
1135071152 16:19353000-19353022 CTGCCAACACAGGTCTTCCGTGG - Intergenic
1135824916 16:25718184-25718206 CTGGATTAACAGTTCTTCAAAGG - Intronic
1135994388 16:27237357-27237379 CTGGAAAAACAGGCCATCCAAGG - Intronic
1136093084 16:27934653-27934675 CTGGAGCCACAGCTCTCCCATGG - Intronic
1136627001 16:31467387-31467409 CTGGACACACAGATCTTGCTTGG + Intergenic
1137609289 16:49808317-49808339 CTGTAATCCCAGTGCTTCCAGGG - Intronic
1138133973 16:54505416-54505438 CTGGCACATCAGTTCTTCCATGG + Intergenic
1139158214 16:64470415-64470437 CTGGAAATACAGATCTACCTTGG + Intergenic
1139163063 16:64534725-64534747 CTGGCAGCACAGTTCTTCCCAGG - Intergenic
1139202053 16:64987881-64987903 AGGGAAGCACAGTTCTCCCATGG - Intronic
1139275366 16:65722845-65722867 GTGGAAAGACAGTTTTTCCATGG - Intergenic
1140241383 16:73204160-73204182 CATGAAAGACAGTTTTTCCACGG + Intergenic
1143013097 17:3877056-3877078 CTGGGAGCAGAGTTCTTCCTAGG + Intronic
1144669390 17:17124451-17124473 ATGGATACACAGCTCATCCAGGG + Intronic
1144877509 17:18409125-18409147 CTGGAAACACAGTTGTGAAAAGG - Intergenic
1145426982 17:22912337-22912359 CTGGAAACACTCTTTTTGCAGGG + Intergenic
1145434856 17:23020596-23020618 CTGGAAACACTCTTTTTGCAGGG + Intergenic
1145760639 17:27423599-27423621 TTGGGTATACAGTTCTTCCATGG - Intergenic
1146166701 17:30595208-30595230 CTGCAAACACATTTTTACCAAGG + Intergenic
1146423439 17:32712021-32712043 CTGGGCACGGAGTTCTTCCAAGG + Exonic
1147623177 17:41881756-41881778 CTGGCTACACAGATCTACCAAGG + Intronic
1149154783 17:53614778-53614800 CTGGGATCACAGTTCTTTGAGGG - Intergenic
1150883723 17:69060890-69060912 CTAGAAACACAGTTCATCCATGG + Exonic
1150975385 17:70080232-70080254 CTGTAAACACAGTTATTCAGAGG - Intronic
1151473444 17:74331909-74331931 CTGGAATCACTGGCCTTCCAAGG - Intronic
1151907266 17:77056638-77056660 CTGGAAACACAATACCTCCCTGG + Intergenic
1152325410 17:79633182-79633204 CTGTACTCACAGTTTTTCCAGGG - Intergenic
1152732671 17:81980278-81980300 CTGTAAAAACAGGTCTTCAAGGG - Intronic
1153643067 18:7172280-7172302 CTGGAGACACAGGGCTACCAGGG + Intergenic
1157258222 18:46157053-46157075 CTGGGAACACAGTGTCTCCAAGG + Intergenic
1157723109 18:49941073-49941095 CATGAAACACAGTTGTTTCATGG - Intronic
1157786060 18:50483690-50483712 CAGGCAGCACACTTCTTCCATGG - Intergenic
1158177617 18:54675135-54675157 CTAGAAACACAGTCCTTCCCAGG - Intergenic
1158763086 18:60413962-60413984 CTTGGAAGACAGTTTTTCCATGG + Intergenic
1159041848 18:63331749-63331771 TTGGAAACAGTCTTCTTCCAAGG + Exonic
1159232468 18:65627223-65627245 CTGTAGACACAGTGCATCCATGG + Intergenic
1160158666 18:76453430-76453452 GTGAAAACCCAGTGCTTCCATGG - Intronic
1165038657 19:33053342-33053364 CTGGAAATACAGTTGATTCATGG - Intronic
1167169142 19:47819717-47819739 CTGGATCCAGAGTCCTTCCAGGG - Intergenic
1167208802 19:48120317-48120339 CTGAAAACAAAGTACTTCCAGGG + Intronic
1167482442 19:49741426-49741448 ATGGAACCACAGCTCTTCCTGGG - Intronic
1167820251 19:51921355-51921377 CTGCAAACACATTTTTACCAAGG - Intronic
1168260171 19:55188931-55188953 CTGGACGCACACTTCTTACAGGG + Intronic
1168443758 19:56393984-56394006 CTGGTAAAACTGTTGTTCCACGG - Intergenic
1168572939 19:57485264-57485286 CTGGAAACTCTGGACTTCCATGG - Intergenic
925219398 2:2125839-2125861 ATGGAAATACAGTTCTTCAATGG - Intronic
925247970 2:2401592-2401614 TTGGTACCAGAGTTCTTCCATGG - Intergenic
925695142 2:6568500-6568522 CTGGAAACCAAGCTCTTCCTAGG - Intergenic
928925787 2:36577687-36577709 CTGGAAATACAGTTCTAGGATGG - Intronic
929751090 2:44714451-44714473 CTGTAAAGACAGTTCTTCAGGGG + Intronic
930084692 2:47487531-47487553 CATGAAATACTGTTCTTCCAGGG - Intronic
932981825 2:76678107-76678129 CTGAAAGCACTGTGCTTCCATGG - Intergenic
933460056 2:82571209-82571231 CTAGATACACACTTATTCCAAGG - Intergenic
933635375 2:84702859-84702881 TTCGAAAAACAGTTCTTCCCAGG + Intronic
935881226 2:107568170-107568192 CTGGCCCCACATTTCTTCCAAGG - Intergenic
935952704 2:108345406-108345428 CTGGGAAACCAGTTTTTCCACGG - Intergenic
936041333 2:109152146-109152168 CTGGAATTACATTTCTTCCTAGG + Intronic
936070121 2:109363621-109363643 CTTTAAAAACAGTTCTTGCAAGG + Intronic
938647783 2:133349279-133349301 CTGGAAACTCTCTTCTTCCTAGG - Intronic
938669889 2:133576801-133576823 GTGGAAACCCAGTTCATCAATGG + Intergenic
938867678 2:135440657-135440679 TTGGAAACAGATTTTTTCCATGG + Intronic
939168562 2:138666737-138666759 CTGGAAAAACATTACTTCTAAGG + Intergenic
940111531 2:150160241-150160263 TTGGAATCACATTTCCTCCACGG - Intergenic
941232848 2:162932721-162932743 CTGTAAACTCAATTTTTCCAAGG - Intergenic
941790593 2:169548164-169548186 CTGGAAACATTGTTCTGACATGG - Intronic
942220400 2:173763396-173763418 CTGGCAACCCAGGCCTTCCATGG + Intergenic
942764651 2:179440590-179440612 ATGGAAACACAATTCCTTCAGGG + Intergenic
943703884 2:191014648-191014670 CTTGAAACACGTTTCTTCCTTGG + Intronic
944161190 2:196662360-196662382 CTTGGAAGACAGTTTTTCCATGG + Intronic
945647582 2:212518819-212518841 CTGGACAAACAGTGATTCCAGGG + Intronic
945889964 2:215419990-215420012 CTGGTAACACAGCTCTTTTAAGG + Intronic
946806427 2:223475270-223475292 CATGGAAGACAGTTCTTCCATGG - Intergenic
1169287734 20:4323570-4323592 CAGGAAACTCAGTGTTTCCATGG - Intergenic
1169637514 20:7708816-7708838 CTGAAAACTGAGCTCTTCCATGG + Intergenic
1169712900 20:8584620-8584642 TTGGAAAAACAATTCTTCCATGG - Intronic
1170204285 20:13781661-13781683 CTGGACACACAGAGCTCCCAGGG - Intronic
1170768188 20:19309854-19309876 CTGGAAGCCCAGCTCTCCCAGGG - Intronic
1170909184 20:20546972-20546994 TTGGAAACAGAGTTACTCCAAGG + Intronic
1172506529 20:35466954-35466976 CTGAACACACAGTTCTTCAAGGG + Exonic
1172739177 20:37151856-37151878 ATGGAAAGAAATTTCTTCCATGG + Intronic
1173047120 20:39523174-39523196 CTTGTAAGTCAGTTCTTCCATGG + Intergenic
1174079100 20:47958324-47958346 CTGGACTCCCAGTTCCTCCAAGG + Intergenic
1175480189 20:59305164-59305186 CTGGGATCACAGTTCATCAATGG + Intronic
1175781900 20:61688188-61688210 CCAGAAACACCCTTCTTCCACGG + Intronic
1175810929 20:61856905-61856927 CTGGAAACACATCTCAGCCAGGG - Intronic
1175862851 20:62159424-62159446 GGGGAAGCACAGTTCTGCCAGGG - Intronic
1178142417 21:29699381-29699403 CTGGACACACAGATATACCAGGG + Intronic
1178373272 21:32045356-32045378 TAAGAAACACAGTTCTTGCAAGG - Intergenic
1178469198 21:32876557-32876579 CTGGAAAAACAGCACTTCAAGGG + Intergenic
1178635080 21:34295319-34295341 CTGGAGCCACAGTTCTTCCAGGG - Intergenic
1181149795 22:20875070-20875092 CTGGAGCCACAGGACTTCCATGG - Intronic
1181464545 22:23103834-23103856 CTGGCTACACAGGTCCTCCAGGG - Intronic
1181676089 22:24454196-24454218 CTGGGACCACAGCTGTTCCAGGG - Intergenic
1182249292 22:28987215-28987237 CCAGAAACACAGTGATTCCAAGG - Intronic
1183336628 22:37251522-37251544 GTGGAAACAGACATCTTCCATGG + Intergenic
1183627292 22:39012278-39012300 CTGCAAACACATTTTTACCAAGG + Intergenic
1184255816 22:43286281-43286303 CTGGAACCCCAGCTCTACCATGG - Intronic
949295624 3:2519171-2519193 CTTGAAACACAGTTGGTACAAGG - Intronic
949619213 3:5791116-5791138 CTAGAAACACCATTCTTCAAGGG + Intergenic
949755144 3:7400635-7400657 CTCAAATCACAGCTCTTCCATGG + Intronic
950204144 3:11065038-11065060 TTAGAAAAACAGTTCTTCCAAGG - Intergenic
950873916 3:16253059-16253081 AGGGAAATACAATTCTTCCATGG - Intergenic
951991951 3:28684836-28684858 CTGGGAACATGTTTCTTCCAGGG - Intergenic
952202082 3:31140709-31140731 CTGAAGACACAGTTATTCCTTGG + Intergenic
952312961 3:32206913-32206935 CTGGAAATGCAGTTATTCTATGG + Intergenic
952905762 3:38138323-38138345 GTGGAGCCACAGTTCTTCCACGG - Intergenic
956631433 3:71320360-71320382 CTGGAACCACCATTCTACCACGG + Intronic
957251372 3:77775087-77775109 CTGAAAGCTAAGTTCTTCCATGG - Intergenic
958189472 3:90166350-90166372 CTTGAACTGCAGTTCTTCCAAGG - Intergenic
958411785 3:93825954-93825976 CTTGAACTGCAGTTCTTCCAAGG - Intergenic
958497632 3:94864754-94864776 CTGCAACCATAGTTTTTCCAGGG - Intergenic
959407774 3:105981472-105981494 CTGTAAACACACTTCTAGCAAGG - Intergenic
960598862 3:119435003-119435025 CTGAAAATACAGTAATTCCATGG + Intronic
962539122 3:136360618-136360640 CTGAAGGAACAGTTCTTCCAGGG + Intronic
965009034 3:163062719-163062741 CAGGACCCACACTTCTTCCATGG + Intergenic
965289456 3:166860567-166860589 TTGAAAACACAGCTCTTCTAAGG - Intergenic
966040461 3:175479859-175479881 CTGAAAAAACAGTTCTCCTAAGG + Intronic
969173068 4:5379368-5379390 CAGGAAACACAGCTCCTCCCGGG + Intronic
970503850 4:16706659-16706681 ATAGAAACAGAGTTCTTCCTAGG + Intronic
971075803 4:23147849-23147871 GTGCAAGCTCAGTTCTTCCATGG + Intergenic
971139330 4:23906639-23906661 ATGGAAACACAGTTGTAGCATGG - Intergenic
971570658 4:28206450-28206472 CTGGAACAAAAGTACTTCCAGGG - Intergenic
973397800 4:49611511-49611533 CGTGAAACACAAATCTTCCATGG + Intergenic
974808900 4:66920493-66920515 CACGAAAGACAGTTTTTCCAGGG + Intergenic
975301438 4:72795702-72795724 CTTGGAAGACAGTTCTTCCATGG - Intergenic
975625390 4:76340851-76340873 CATGAAAGACAGTTTTTCCATGG - Intronic
976658293 4:87512224-87512246 CTGTAATCCCAGTACTTCCAGGG - Intronic
978174767 4:105716696-105716718 CATGAAAGACAGTTTTTCCATGG - Intronic
981327937 4:143473538-143473560 GTGGCAACAGAGTTTTTCCAGGG - Exonic
981383916 4:144104823-144104845 GTGGAATCACATTCCTTCCAAGG + Intergenic
981527290 4:145719616-145719638 TTGGAAACACAGTTTTTCAAAGG - Intronic
982372068 4:154644752-154644774 CTGGTAACCCAGGTCTACCAGGG + Intronic
982483496 4:155939449-155939471 CTGGACACTTAGGTCTTCCAGGG + Exonic
983529051 4:168791119-168791141 CTGCAAACACACTTCCTCCTGGG - Intronic
986047980 5:4059141-4059163 CTGCAAGCACAGTTCTTGGAGGG - Intergenic
987524961 5:19035530-19035552 CAGGAAACACATTTCTTCCAAGG - Intergenic
989855064 5:46275287-46275309 CTGGAAACACTGTTTTTATAGGG - Intergenic
991002745 5:61798769-61798791 CTGGACACACCGTTATGCCATGG - Intergenic
993137952 5:83993855-83993877 CTGTATACCCAGGTCTTCCAAGG + Intronic
993650599 5:90516933-90516955 ATGTAAACAAAGTTCTTCAAAGG + Exonic
993809245 5:92455458-92455480 CTGAAAAGTCAGTGCTTCCATGG - Intergenic
995223606 5:109678706-109678728 CTGAAAACCCAGTGCTTTCAAGG + Intergenic
996080277 5:119251449-119251471 GTGGGAAGACAGTTATTCCATGG - Intergenic
998330693 5:141323791-141323813 CTGGTATCACAGATATTCCATGG - Intergenic
999063983 5:148665350-148665372 CTGGCCTCACAGTCCTTCCACGG + Intronic
999242450 5:150135824-150135846 CTGGAACCACAGATCTCTCAGGG - Exonic
1000386146 5:160676251-160676273 ATGGAAACACAGTGCTTCAGAGG + Intronic
1000814595 5:165905304-165905326 CTGCAGACACAGTTTTGCCATGG - Intergenic
1001016623 5:168147577-168147599 CCGGAGACTCAGTTCTTCTAAGG - Intronic
1002913446 6:1509141-1509163 CTGGAGAGAGAGATCTTCCACGG + Intergenic
1003350821 6:5316480-5316502 CTGTCACCTCAGTTCTTCCATGG - Intronic
1003893501 6:10584698-10584720 CTGCAAACACATTTTTACCAAGG + Intronic
1005589708 6:27311344-27311366 CTGGGAACACTTCTCTTCCAAGG + Exonic
1008136129 6:47779358-47779380 ATGGAAAAAGAGTTGTTCCATGG - Intergenic
1008484965 6:52025776-52025798 GTTGAGACACAGTCCTTCCAGGG - Exonic
1008776750 6:55049031-55049053 ATGAAAACACATTTCTTGCATGG + Intergenic
1010311781 6:74395311-74395333 CTGGAAACTTAGTTCCTCAAAGG + Intergenic
1010734503 6:79428602-79428624 CTGGAAAGTCAGTTGTTCCAAGG - Intergenic
1012773094 6:103466041-103466063 CTGGAACGTCAGTTCTTCCAGGG - Intergenic
1012949184 6:105499763-105499785 CTGGAAACAGACTGCTGCCAAGG + Intergenic
1014270988 6:119335817-119335839 GTGGAAGCACAGTCCTTCCTGGG + Intronic
1014573708 6:123044210-123044232 CTGGCTACACAGTTCTTCACTGG - Intronic
1016025934 6:139287011-139287033 CAGGGAAGACAGTTTTTCCATGG - Intronic
1016104957 6:140149972-140149994 GTAGAAACACAATTCTTCTAAGG - Intergenic
1018050119 6:160001534-160001556 CATGAAAGACAGTTTTTCCATGG - Intronic
1019834066 7:3363566-3363588 CTTCAAAGACAGTTTTTCCATGG + Intronic
1020556400 7:9675374-9675396 CTGGAAAAATATTTCTTGCAGGG - Intergenic
1020559250 7:9709126-9709148 CTGGAAAAATGGTTTTTCCAAGG + Intergenic
1020972967 7:14969693-14969715 CATGAAAGACAGTTTTTCCATGG - Intronic
1021785431 7:24146791-24146813 CTTGAAAGACAATTTTTCCATGG + Intergenic
1027263638 7:76481996-76482018 CTGGAAACACATAGTTTCCAGGG - Intronic
1028182209 7:87738198-87738220 TTAGAAGCATAGTTCTTCCAGGG + Intronic
1028774269 7:94659828-94659850 CTGGAAACACAATTCTTACATGG - Intronic
1031973527 7:128079933-128079955 CTGGCACTACAGCTCTTCCAGGG - Intronic
1033549581 7:142434500-142434522 CTGAAAACTCACTTCTTCCTTGG - Intergenic
1034066716 7:148144024-148144046 CTGGAAACACAGAGATTCCAGGG + Intronic
1034318664 7:150159255-150159277 CTGGAGAAACACTTCTTCCCAGG + Intergenic
1034774092 7:153807957-153807979 CTGGAGAAACACTTCTTCCCAGG - Intergenic
1035904341 8:3492787-3492809 CTGGAATCAGAGTTCTTCAAAGG + Intronic
1036019656 8:4830107-4830129 TTGGAAACTCAGTTCTGCAAAGG + Intronic
1036205723 8:6804480-6804502 CAGGAAGCACACTCCTTCCATGG - Intergenic
1036544528 8:9754139-9754161 CTGCAGACACTTTTCTTCCAAGG + Intronic
1038195060 8:25359738-25359760 CAGGAAAGACAATTTTTCCACGG - Intronic
1038420582 8:27431577-27431599 CTGAAAGCAGAGTTCTTCTAAGG + Intronic
1039312953 8:36338843-36338865 CTTGAGACACATTTCTTCAAAGG - Intergenic
1039980638 8:42407115-42407137 ATGGACACACCTTTCTTCCAAGG - Intergenic
1040528289 8:48243730-48243752 ATGGACACACCTTTCTTCCAAGG + Intergenic
1043345499 8:79293268-79293290 CTGGAAACACTGTGCTTCTTTGG + Intergenic
1043519595 8:81029995-81030017 CTGGACAAACATTTCCTCCAAGG - Exonic
1044731116 8:95229386-95229408 GAGGAAACAGAGTCCTTCCAAGG - Intergenic
1045914440 8:107449656-107449678 TTGAAAACATAGTTATTCCAAGG - Intronic
1046928350 8:119817477-119817499 CTTGGAAGACAGTTTTTCCACGG - Intronic
1048085942 8:131179554-131179576 ATGGAATCACAGTCCCTCCATGG - Intergenic
1048198551 8:132352557-132352579 CTGGCACCACAGTGCTTGCAGGG + Intronic
1048759253 8:137773642-137773664 CTGGCATGCCAGTTCTTCCAGGG - Intergenic
1050969431 9:11850397-11850419 GAGGAAACTCAGTTCTTTCAAGG - Intergenic
1051122870 9:13771201-13771223 CAGGAAACACAGCGCTACCAGGG - Intergenic
1052343779 9:27388145-27388167 TTGGAAACAAGGTTTTTCCAAGG - Intronic
1052712133 9:32069823-32069845 CTGGTAACACAGGTCTCCTAAGG + Intergenic
1055093082 9:72382730-72382752 CTGGAAACACATTGTCTCCAAGG + Intergenic
1055491748 9:76812186-76812208 CTGGGAAGACAGGGCTTCCAAGG + Intronic
1055782654 9:79836084-79836106 CTAGAAACACATTTCTTACCTGG - Intergenic
1061901884 9:133677263-133677285 CTGGAAACCCACATCCTCCAGGG + Intronic
1186809778 X:13176859-13176881 GTGGAAACACAGTCCTTCCCAGG + Intergenic
1188530722 X:31138014-31138036 CTGGGAAAACAGTACTTCCCTGG + Intronic
1188842395 X:35032193-35032215 CTGGAAAGACTGTTCCTCCCAGG - Intergenic
1195599816 X:106733333-106733355 TTGAAAACACATATCTTCCAGGG - Intronic
1196331873 X:114480637-114480659 CTGGAAACACAATTTCTTCAAGG - Intergenic
1196403192 X:115337301-115337323 CTCTAAACAGACTTCTTCCAAGG + Intergenic
1196775329 X:119332750-119332772 TTGGAAACACAGGTTCTCCAAGG - Intergenic
1197295764 X:124717185-124717207 CTGGTAACACATTCATTCCATGG + Intronic
1197934808 X:131729237-131729259 CAAGGAACACAGTTATTCCAAGG + Intergenic
1200825518 Y:7635353-7635375 CGGGAAACACAGTTCTGCCATGG + Intergenic
1202234539 Y:22695742-22695764 CGGGAAACACAGTTCTGCCATGG - Intergenic
1202308620 Y:23500426-23500448 CGGGAAACACAGTTCTGCCATGG + Intergenic
1202562181 Y:26170160-26170182 CGGGAAACACAGTTCTGCCATGG - Intergenic