ID: 919643283

View in Genome Browser
Species Human (GRCh38)
Location 1:200066321-200066343
Sequence TGGGAGCCATTTGTGGAGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 485
Summary {0: 1, 1: 0, 2: 3, 3: 101, 4: 380}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919643283 Original CRISPR TGGGAGCCATTTGTGGAGAA GGG Intronic
900901327 1:5518353-5518375 TGTGAGTTATTTGTGCAGAAGGG - Intergenic
900967168 1:5966819-5966841 AGGGAGCCATTTGGGAAGGATGG - Intronic
903848989 1:26295173-26295195 GGGGTGCCATTTCTGGAGACAGG - Intronic
904201007 1:28818977-28818999 TTGGAGCAATCTGTGCAGAATGG + Intronic
904353501 1:29924059-29924081 GAGGAGGCATTTGTGGAGGAGGG - Intergenic
906438226 1:45815739-45815761 TGGAAGCCATGTGTAGAAAATGG - Intronic
906577337 1:46902648-46902670 TGGCATCCATGTGTGAAGAAGGG - Intergenic
907903982 1:58767436-58767458 TGGAAGCCATATGCGAAGAATGG + Intergenic
908029008 1:59980377-59980399 TGGGGGCCATTTGAGGAGATAGG - Intergenic
910908268 1:92205748-92205770 TGGGACCTATGTGTGCAGAAGGG - Intergenic
913975011 1:143449210-143449232 TGGAATCCATTTGGGGTGAAAGG + Intergenic
914069403 1:144274826-144274848 TGGAATCCATTTGGGGTGAAAGG + Intergenic
914109752 1:144691528-144691550 TGGAATCCATTTGGGGTGAAAGG - Intergenic
915480115 1:156178645-156178667 AGAGAGCCATTTGAGCAGAAAGG - Intergenic
915587650 1:156852752-156852774 TGGGAGCGATCTGTGGGGTAGGG + Intronic
918083175 1:181222964-181222986 CTGGAGCGATGTGTGGAGAAAGG - Intergenic
918575943 1:186060395-186060417 TGGGCACCATTTGAGGAGTAAGG - Intronic
918685276 1:187407534-187407556 TGGGGGCCATTTGTCGACATGGG + Intergenic
919142611 1:193591486-193591508 TGGGAGCCAGATTTTGAGAAAGG - Intergenic
919643283 1:200066321-200066343 TGGGAGCCATTTGTGGAGAAGGG + Intronic
920325791 1:205162675-205162697 TGGGTGCTCTTTGTGGACAATGG - Intronic
920450563 1:206058148-206058170 TGGGAGCCATGTTTGGAAATTGG + Intronic
921033405 1:211353725-211353747 TGGGAGCTGGCTGTGGAGAAGGG + Intronic
922549674 1:226484778-226484800 TGGAAGCCATGTGTTGAGGAGGG + Intergenic
922572851 1:226644133-226644155 CGGGGGCCCTTTTTGGAGAAAGG - Intronic
923308241 1:232708454-232708476 TGGGAACCAGTTGTGTAGCAGGG + Intergenic
1063998410 10:11642429-11642451 TGGGAGCCACGTGTGGAAGATGG + Intergenic
1065909623 10:30290580-30290602 AGGCATCCATTTGTGGAGCAGGG - Intergenic
1066793730 10:39095435-39095457 TGGGAGCCCTTTGTGGCATATGG + Intergenic
1066794128 10:39100053-39100075 TGGGAGCCCATTGTGGCCAATGG + Intergenic
1066814488 10:39387724-39387746 TGGGAGCCCTTTGAGGCCAATGG - Intergenic
1066818456 10:39452263-39452285 TTGGAGCCCTTTGTGGACTAAGG - Intergenic
1066818880 10:39457053-39457075 TTGGAGCCCTTTGTGGCCAATGG - Intergenic
1066818962 10:39458761-39458783 TTGGAGCAATTTGTGGTGTATGG - Intergenic
1066929951 10:41745643-41745665 TGGGAGCCCTTTGGGGCCAATGG + Intergenic
1066934768 10:41814395-41814417 TGTGATCCATTTGTGGCGTATGG - Intergenic
1067729005 10:48795650-48795672 TTGGAGCCATTGATGGGGAATGG + Intronic
1067761673 10:49053212-49053234 TGGGAGCTCATTGTGGAGCAAGG + Intronic
1067933301 10:50585304-50585326 AGGTAGCCATGTCTGGAGAAGGG - Intronic
1068541939 10:58304557-58304579 TGGGAGCCATTGGCCGAGACTGG + Intergenic
1068891746 10:62155336-62155358 GAGGAGGGATTTGTGGAGAAGGG + Intergenic
1070888005 10:79921690-79921712 TGCAAGCCATATGTGGAGACGGG + Intergenic
1072530875 10:96317705-96317727 TGGGTGCCATCTATGAAGAATGG + Intronic
1072688806 10:97556200-97556222 TGGGAGCCATGTTTGGAAATTGG - Intronic
1073142524 10:101258245-101258267 TGGAAGCCATGTGTTGAGAATGG - Intergenic
1074301907 10:112240733-112240755 TGGGAGCCAGGAGTGGAGAGAGG + Intergenic
1074947587 10:118296360-118296382 TGGGAGACAGGTGTGTAGAAAGG + Intergenic
1078839854 11:15068518-15068540 TGGCATCCATGTGTGAAGAAGGG + Intronic
1079370215 11:19846176-19846198 TGGAACCCATTTCTGGAGAATGG + Intronic
1080006176 11:27409515-27409537 TGGGTGCCATTTGCTGAGACCGG - Intronic
1080467100 11:32507877-32507899 AATGAGCCATTTTTGGAGAATGG - Intergenic
1080612391 11:33915774-33915796 TGGGATTCTTTTATGGAGAAGGG - Intergenic
1081848224 11:46256477-46256499 TGGAAGCCATGTGTGGAAGATGG - Intergenic
1082147929 11:48693753-48693775 TGGGAGCCCTTTGTGGCCAATGG + Intergenic
1082153052 11:48766159-48766181 TGGGATCCCTTTGTGGCCAAAGG - Intergenic
1082153093 11:48766841-48766863 TGGGAGCCCTTTGAGGACTATGG - Intergenic
1082153209 11:48768726-48768748 TGGGAGCCCTTTGAGGGCAATGG - Intergenic
1082265924 11:50118237-50118259 TGGGAGCCCTTTGTGGTCTATGG - Intergenic
1082290164 11:50360335-50360357 TGGGAGCCCTTTGTGGTCTATGG + Intergenic
1082292633 11:50396876-50396898 TGGGAGCGCTTTGAGGACAATGG + Intergenic
1082299206 11:50485705-50485727 TGGGAGCTCTTTGAGGAAAATGG - Intergenic
1082303496 11:50541266-50541288 TGGGAGCTCTTTGAGGACAATGG - Intergenic
1082311757 11:50658323-50658345 TGGGAGCCCTTTGAGGCCAAAGG + Intergenic
1082312105 11:50663634-50663656 TGGGAGCTAATTGAGGTGAAAGG - Intergenic
1082319496 11:50782838-50782860 TTGGAGCCATTTGTGGCCTATGG - Intergenic
1082582546 11:54890668-54890690 TGGGAGCTTTTTGTGGTCAAGGG + Intergenic
1082585274 11:54930069-54930091 TGGGAGCTCTTTGAGGTGAATGG - Intergenic
1082585473 11:54932942-54932964 TGGGAGCGATTTGAGGCCAATGG - Intergenic
1082590030 11:54995392-54995414 TGGGAGCCCTTTGTGGCCAATGG + Intergenic
1082595362 11:55072979-55073001 TGGGAGCTCATTGAGGAGAATGG + Intergenic
1082601014 11:55154340-55154362 TGGGAGCCCTTTGAGGCAAATGG - Intergenic
1082601194 11:55157688-55157710 TGGGAGACATTTGAGGTCAATGG - Intergenic
1082602791 11:55180690-55180712 TGGGATCCCTTTGTGGCCAAAGG - Intergenic
1082604742 11:55211730-55211752 TGGGAGCCCTTTGAGGACTATGG - Intergenic
1082604802 11:55212753-55212775 TGGGAACCCTTTGAGGAGTATGG - Intergenic
1083598591 11:63932295-63932317 TCGGAGCCGAGTGTGGAGAAGGG + Intergenic
1087220595 11:95542639-95542661 TGGGAGTCATTTGTGTTGCATGG - Intergenic
1089500540 11:118929199-118929221 TGGGAGCCAATAGAGGAGCAGGG + Intronic
1089846236 11:121460774-121460796 TAAGAGCCACCTGTGGAGAAAGG + Intronic
1090234127 11:125133935-125133957 TGAGAGCCTTTAGTGGGGAAAGG - Intergenic
1090668245 11:128929464-128929486 TCGGGGCCATGTGTGGAGAGAGG + Intergenic
1093089014 12:14900916-14900938 TGGGACCCATTTAGGGAAAAGGG - Intronic
1093649464 12:21626620-21626642 TGTGAGCCTTTGGAGGAGAAGGG + Intergenic
1094859039 12:34439054-34439076 TTGGAGCTCTTTGTGGACAATGG - Intergenic
1094860447 12:34460284-34460306 TGGGAGCCCTTTGAGGCCAAAGG - Intergenic
1094877196 12:34662839-34662861 TGGGTGCCCTTTGTGTATAAAGG + Intergenic
1095036741 12:37388942-37388964 TTGGAGCCATTTGAGGCCAATGG + Intergenic
1095061074 12:37689740-37689762 TGGGAGCCCTTTGTGGCCGATGG - Intergenic
1095062539 12:37716368-37716390 TTGGAGCCCTTTGTGGCCAATGG + Intergenic
1097573833 12:61365696-61365718 TGGGAACCATTTGTTTATAACGG + Intergenic
1099210525 12:79782379-79782401 TGTGAACCAATTGTGGAGCATGG - Intronic
1099530156 12:83769119-83769141 AGGATGCCATTTGTGCAGAAAGG - Intergenic
1101554772 12:105798766-105798788 AGGGAGTTATTTTTGGAGAAGGG - Intergenic
1101568128 12:105928816-105928838 TGGGAACTCTTTGTGGAGACAGG - Intergenic
1102047027 12:109835741-109835763 TGGGACCCATTTCTGCAGAAAGG + Intergenic
1103293442 12:119866202-119866224 TGGGTGCTATTTTTGGAGACTGG - Intronic
1104054483 12:125219059-125219081 TGAGAGCCATCTGTGGTGAGAGG + Intronic
1104629082 12:130384762-130384784 TGGGAGGCATTAGAGGACAAAGG - Intergenic
1104757393 12:131277766-131277788 TGGGAACCATTAGAGGTGAAAGG - Intergenic
1105968258 13:25404321-25404343 TGGCTGGCATTTGTGGAGCAAGG + Intronic
1109795636 13:67309499-67309521 TGTGAGACATCTGTGGAGAATGG + Intergenic
1110372248 13:74752985-74753007 AGGGAGCTATGTTTGGAGAATGG - Intergenic
1110541940 13:76715920-76715942 TTGAAGCAATATGTGGAGAAGGG + Intergenic
1112551544 13:100425527-100425549 TGGGAGCCATCTGTTTAAAATGG + Intronic
1112616435 13:101011520-101011542 TGGGAGGTGTTTGTGGGGAAGGG - Intergenic
1112917294 13:104567213-104567235 AGGAAGCCAGTTGTGGAGAAGGG + Intergenic
1113931129 13:113969541-113969563 CGGGAGCCATTTGTAAATAAGGG + Intergenic
1114698151 14:24646797-24646819 TTGGATCCATTTCTGGAGAGTGG - Intergenic
1116417792 14:44699368-44699390 TGTGAGTCATTCGTGGAAAAGGG + Intergenic
1117024415 14:51605637-51605659 TGGGTGCCATTTCTGCAGATGGG - Intronic
1117268265 14:54113691-54113713 TTGGAGTCATATGGGGAGAAGGG - Intergenic
1118814455 14:69300090-69300112 TCAGAGCCATTTGTGGGGAAAGG - Intronic
1122822917 14:104356089-104356111 TGGGAGGCATTTGGGGAGCCGGG + Intergenic
1123224841 15:17013534-17013556 TTGGAGCCCTTTGTGGCCAATGG + Intergenic
1123226218 15:17035081-17035103 TTGGAGCGCTTTGTAGAGAATGG + Intergenic
1124651945 15:31480518-31480540 TGAGGGCCCTTTGTGGAGCAGGG - Exonic
1125293598 15:38177177-38177199 TGGGAGGGAGTGGTGGAGAAGGG - Intergenic
1128046312 15:64620787-64620809 TCAGAGCCAACTGTGGAGAATGG + Intronic
1128691393 15:69727049-69727071 TGTGTGCCATCTGAGGAGAATGG - Intergenic
1128749495 15:70138962-70138984 TGGAAGCCAACTGTGAAGAAGGG - Intergenic
1129244355 15:74270652-74270674 TGGGAGCCATTGGTGGATACAGG + Intronic
1129474012 15:75771283-75771305 TGGGAGCCATGTGTGGACCCAGG + Intergenic
1129653331 15:77506763-77506785 AGGGAGCCATCTGTGGAAACAGG + Intergenic
1129782945 15:78286477-78286499 AGGAAGCCATCTGAGGAGAAGGG + Intronic
1130236186 15:82135884-82135906 TGGGAGCTAAGTGTTGAGAAAGG + Intronic
1131373428 15:91903643-91903665 TGGGAGGCCTTTGTGGAGGGAGG + Intronic
1132002369 15:98193128-98193150 TGGGAGCCCTTTAAGGGGAATGG - Intergenic
1132156667 15:99500579-99500601 TGGGTGGCATTTTTGGAGAGGGG + Intergenic
1132710336 16:1263499-1263521 TGGGAGCCACTGGTGTAGACAGG - Intergenic
1136002689 16:27306926-27306948 TGGGAGCCATTTGGGAATCATGG - Intergenic
1136116593 16:28098460-28098482 TGGGAGACATCTGTGGTGGAAGG + Exonic
1136397474 16:30001081-30001103 TGGGCGTCATTTGGGCAGAAGGG + Intronic
1136743866 16:32565690-32565712 TGGGAGCCAATTGTGGCCCATGG + Intergenic
1136916669 16:34209492-34209514 TTGGAGCCATTTGTGGCCTATGG - Intergenic
1138352351 16:56352680-56352702 TGGGAGCAGTGTGTGAAGAAGGG + Intronic
1141410683 16:83830742-83830764 TGAGAGACTTTTGTGGGGAAGGG + Intergenic
1141442721 16:84039931-84039953 TGGGAGACATTTGATGAAAACGG - Intronic
1141682468 16:85552714-85552736 TGGGAGCCACCTGTGGAGATTGG - Intergenic
1203011845 16_KI270728v1_random:299969-299991 TGGGAGCTATTTGAGGTCAAAGG + Intergenic
1203025732 16_KI270728v1_random:509543-509565 TGGGAGCCAATTGTGGCCCATGG - Intergenic
1203030180 16_KI270728v1_random:573128-573150 TGGGAGCTATTTGAGGTCAAAGG + Intergenic
1203041541 16_KI270728v1_random:761303-761325 TGGGAGCTATTTGAGGTCAAAGG - Intergenic
1203045989 16_KI270728v1_random:824888-824910 TGGGAGCCAATTGTGGCCCATGG + Intergenic
1142748093 17:1970561-1970583 TGGGGGCCATCTTTGGAGACTGG + Intronic
1144330772 17:14222111-14222133 TGAGAACCATTGGTGGAGGAAGG + Intergenic
1144523751 17:15972202-15972224 AGGGAGCCATTGGTTAAGAATGG + Intronic
1144736611 17:17559188-17559210 TTGGAGCCAGGCGTGGAGAAGGG - Intronic
1147759804 17:42790123-42790145 AGGAAGCCATCTGTGGACAAAGG + Intronic
1152504477 17:80738574-80738596 GGGGAAGCATTTGTGAAGAAAGG - Intronic
1154947782 18:21179330-21179352 TGGGAGCCATTTCTTGGGATGGG - Intergenic
1155434155 18:25793789-25793811 TGGCAGTCATTTGTAGAGAAAGG - Intergenic
1156540277 18:37903024-37903046 TGTGTGCCTTTTGTGGAGAAGGG + Intergenic
1158957357 18:62552568-62552590 TGAGAGCCATTTTTTGAAAATGG - Intronic
1159441453 18:68485706-68485728 TGGAAGCCATTTCTTTAGAATGG - Intergenic
1162664178 19:12195526-12195548 TGGGTGACCTTTATGGAGAAAGG - Intergenic
1162718540 19:12648341-12648363 TCGGAGCCACTAATGGAGAACGG - Exonic
1164327607 19:24212402-24212424 TGGGAGCCCTTTGAGGCCAATGG - Intergenic
1164348786 19:27304944-27304966 TTGGAGCAATTTGTGGCGTATGG + Intergenic
1164351100 19:27343309-27343331 TGTGAGCCATTTATGGCCAATGG - Intergenic
1164353110 19:27377290-27377312 TTGGAGCCATTTGTGGCTTATGG + Intergenic
1164359645 19:27490263-27490285 TGGGAGCCAATTGAGGCCAAGGG + Intergenic
1164363804 19:27550162-27550184 TAGGAGCTTTTTGTGGAGTATGG + Intergenic
1165292953 19:34904200-34904222 TGGGGTCCATTTGAAGAGAAAGG + Intergenic
1166347255 19:42174524-42174546 TGGGTGACATATGTGCAGAAGGG - Intronic
1166870710 19:45868762-45868784 TGGGAGACAGTGGTTGAGAAGGG + Intronic
1167473335 19:49687152-49687174 TGGGAGGCATGAGAGGAGAAAGG + Intronic
926083156 2:10004912-10004934 GGTGAGCCTTTCGTGGAGAAGGG - Intergenic
927619040 2:24632585-24632607 TGGGAGCCAATAATGGAGAAGGG - Intronic
927969519 2:27296526-27296548 TGGCAGCCACATGTTGAGAATGG - Intronic
928766963 2:34658649-34658671 TGAGTGCCATTAGTGAAGAAAGG + Intergenic
929525408 2:42697193-42697215 TAGGAGCCATATGTAGGGAAAGG - Intronic
931426779 2:62178679-62178701 TGGGAGGCATTTCAGGAGAAAGG - Intergenic
931817777 2:65921569-65921591 TGGGATTCAGTTTTGGAGAAAGG + Intergenic
933014978 2:77113683-77113705 TGGTATCCATGTGTGAAGAAGGG + Intronic
933919257 2:87028077-87028099 TGTGAGCTATTTGTGCAGGAGGG - Intergenic
934003737 2:87741830-87741852 TGTGAGCTATTTGTGCAGGAGGG + Intergenic
934179716 2:89610183-89610205 TGGAATCCATTTGGGGTGAAAGG + Intergenic
934290006 2:91684444-91684466 TGGAATCCATTTGGGGTGAAAGG + Intergenic
936694580 2:114930844-114930866 TGAGGGCCAGTTGTGGAAAAGGG - Intronic
936875800 2:117187862-117187884 TGGGTGCCAGTTATGAAGAATGG - Intergenic
937886023 2:126900479-126900501 GTGGGGCCATTTGTTGAGAACGG - Intronic
938517647 2:132031455-132031477 TGTGAACCATTTGTAGACAAAGG - Intergenic
939127263 2:138192699-138192721 AAGGATCTATTTGTGGAGAATGG - Intergenic
940144700 2:150533736-150533758 TGTGAGCCATTGATAGAGAAAGG - Intronic
940347457 2:152642456-152642478 TGTGTGCCATGTGTAGAGAATGG - Intronic
941377526 2:164750310-164750332 GTGGAGCCATTTGTAGAGATGGG - Intronic
941759313 2:169223831-169223853 TGGTAGCCATTTGTGATGAGAGG - Intronic
941844847 2:170122320-170122342 TGGAAGCCATTTCTGCAGGATGG + Intergenic
942376653 2:175344270-175344292 TGGGAGCCCAATGTGGGGAAAGG - Intergenic
943375377 2:187069952-187069974 TGCAAGCAATTTGTGGGGAAAGG - Intergenic
943771963 2:191727695-191727717 TGGGGGCCTCTCGTGGAGAAGGG - Intergenic
944525293 2:200612679-200612701 TGAGAGTCTTTTTTGGAGAAGGG + Exonic
946122231 2:217526294-217526316 GGAGAGCCAATGGTGGAGAAAGG + Intronic
946317686 2:218928558-218928580 TGGAAGCCATATGTTGAGGATGG + Intergenic
946510433 2:220349910-220349932 AGGGATCCATTTGTGGGGCATGG + Intergenic
946859285 2:223985060-223985082 AGGAAGCTATTTGTGGAAAAGGG - Intronic
947834662 2:233166645-233166667 TGGGAGCCATTTCAGGGGAGTGG - Intronic
1168922806 20:1554443-1554465 TGGGTGCCATGTGAGGTGAAGGG + Intronic
1170607319 20:17883780-17883802 GGGGAGCCCTGTGTGGATAAAGG - Intergenic
1171029845 20:21667807-21667829 TGGGAGCTTCTTTTGGAGAAAGG - Intergenic
1171035200 20:21708244-21708266 TGGGAGCCGTGTCTGGACAATGG + Intronic
1171739709 20:28866042-28866064 TTGGAGCCCTTTGTGGCCAATGG + Intergenic
1171744740 20:28958328-28958350 TTGGAGCACTTTGTGGCGAATGG + Intergenic
1171761842 20:29208912-29208934 TTGGAGCCATTTGTGGCCTATGG + Intergenic
1171821742 20:29852992-29853014 TTGGAGCCATTTGTGGCCTATGG + Intergenic
1172633287 20:36393164-36393186 TGGGAGTCATTAGGGCAGAAGGG + Intronic
1173374100 20:42468012-42468034 TCTGAGACATTTGTGGAAAAGGG + Intronic
1173844707 20:46180528-46180550 TGGGACCCATTTGTACTGAATGG + Intronic
1175192446 20:57220587-57220609 TGGGATGCATTTGGGAAGAATGG - Intronic
1176318046 21:5269689-5269711 TTGGAGCACTTTGTGGTGAATGG - Intergenic
1176322531 21:5346972-5346994 TTGGAGCCATTTGTGGCCTATGG + Intergenic
1176475909 21:7206466-7206488 TTGGAGCACTTTGTGGTGAATGG - Intergenic
1176480184 21:7278592-7278614 TTGGAGCCATTTGTGGCCTATGG + Intergenic
1176760936 21:10788466-10788488 TTGGAGCCCTTTGTGGTCAATGG + Intergenic
1178815072 21:35921895-35921917 AGGGAACCATTTGTTTAGAATGG + Intronic
1178915789 21:36704981-36705003 TGGGATCCTTTTGTGGGGAAAGG + Intronic
1179780206 21:43694731-43694753 TGGGAGGCAGCAGTGGAGAAGGG - Exonic
1180395716 22:12333873-12333895 TTGGAGCACTTTGTGGTGAATGG - Intergenic
1180396071 22:12340966-12340988 TTGGAGCCCTTTGTGGCGTATGG - Intergenic
1180398735 22:12387924-12387946 TTGGAGCCATTTGTGGCCAATGG + Intergenic
1180403678 22:12523798-12523820 TTGGAGCCCTTTGTGGCGTATGG + Intergenic
1180404030 22:12530878-12530900 TTGGAGCACTTTGTGGTGAATGG + Intergenic
1181379987 22:22494471-22494493 TGGTGGACATTTGTAGAGAAGGG - Intronic
1181894605 22:26095992-26096014 TGGGAGACATTTGTGGGTAGAGG - Intergenic
1183338343 22:37264035-37264057 TGGGAGTCATTTCTGGAAACTGG - Intergenic
1183612200 22:38916745-38916767 TTGGACCCATCAGTGGAGAAAGG - Intergenic
1184088700 22:42281402-42281424 GGGGAGCCACTTGTGGAGGAAGG - Intronic
949663527 3:6309922-6309944 TGGGGACCATTAGAGGAGAAAGG + Intergenic
950119908 3:10474873-10474895 TGGGAGCCCCTTGTGGGGAGCGG + Intronic
950450715 3:13063592-13063614 TGGGAGGCATTGGGGGACAATGG + Intronic
950901611 3:16503182-16503204 TGGGAGCTATTTTTAGCGAAGGG - Intronic
951421352 3:22489558-22489580 TGGCAGCCATGTGTGAATAATGG - Intergenic
953207580 3:40845384-40845406 TGGTGGCCATGTTTGGAGAAGGG - Intergenic
953479531 3:43238477-43238499 TGGAAGCCATGTTTGGAGGATGG + Intergenic
953900372 3:46837563-46837585 TGGTGGAAATTTGTGGAGAAGGG - Intergenic
954423089 3:50428893-50428915 GGGGAGCCATTTGTGGGGTCTGG + Intronic
954469241 3:50677630-50677652 TTGGAGAAATTTGTGGAGGAGGG + Intronic
954613813 3:51959532-51959554 TGGGACACATTACTGGAGAAGGG - Intronic
956186286 3:66565517-66565539 TGTGAGTCATTTGTGCAGGAGGG + Intergenic
957041984 3:75342624-75342646 TGGGCACCATTGGTGGAGACTGG - Intergenic
960105726 3:113794528-113794550 TGGAAGCCATGTGTTGAAAATGG - Intronic
960750481 3:120946317-120946339 TGGAAGCCATATGTTGAGGATGG - Intronic
961177467 3:124847588-124847610 TAGGAGCCATGTGTGGAAGATGG + Intronic
962231529 3:133669647-133669669 TGGAAGCCATGTGTTGAAAATGG + Intergenic
963302166 3:143610703-143610725 TGGGAGCCCTGTGTGGAAAGGGG - Intronic
964502605 3:157365534-157365556 TGGGGGCCATCTGTGGAGTCTGG - Intronic
966315958 3:178645581-178645603 TGGGAGCCAGTGTAGGAGAATGG + Intronic
967463854 3:189779498-189779520 TGGGAGCCATTTGTGTCCACAGG + Intronic
968761526 4:2444742-2444764 TGGAAGCCAGCAGTGGAGAAAGG - Intronic
972717252 4:41658916-41658938 TGTAATCCATTTGTGGGGAAGGG + Intronic
973529508 4:51820856-51820878 TGGGAGCCCTTTGTGGTCTATGG + Intergenic
973758640 4:54098321-54098343 TTGGAGCCACTGATGGAGAATGG - Intronic
973814589 4:54607461-54607483 TGGGAGTCATTTTTGAAAAAGGG - Intergenic
976734756 4:88298192-88298214 TGTGAGTTATTTGTGTAGAAGGG - Intergenic
977323311 4:95547215-95547237 TGGGAGGCATCTGGCGAGAAAGG + Intronic
978593078 4:110347202-110347224 TGGGAGTCATTTCTGGAGGGTGG + Intergenic
979494901 4:121372080-121372102 TGGGAGCAAGGTGGGGAGAAAGG + Intronic
980749997 4:137076480-137076502 TCTGAGCTATTTCTGGAGAAAGG - Intergenic
981223875 4:142268938-142268960 TGTGAGCAATTTGTGAAGGAGGG - Intronic
981405721 4:144366153-144366175 GGTGAGACATATGTGGAGAAGGG - Intergenic
982551192 4:156801575-156801597 TGGAAGCCATTTATAGAGCATGG + Intronic
982783150 4:159512018-159512040 TGGGAGATATTGGTTGAGAATGG - Intergenic
984193752 4:176634262-176634284 TGAGAGGCATGTGTGGAAAATGG - Intergenic
985663179 5:1167561-1167583 AGGGAGGCCTTTGTGGAGAAAGG - Intergenic
985820787 5:2158827-2158849 TGGGATTCCTTTCTGGAGAAAGG - Intergenic
987220133 5:15782841-15782863 TGGGAGATGTTTGAGGAGAAAGG + Intronic
989830367 5:45909703-45909725 TGGGAGCTCATTGTGGACAACGG + Intergenic
989835874 5:45990102-45990124 TGGGAGCCCTTTAAGGAGTATGG + Intergenic
989841338 5:46075538-46075560 TGGGAGCCCATTGAGGTGAAAGG + Intergenic
989844332 5:46121613-46121635 TGGGAGCTCTTTGAGGACAATGG - Intergenic
989852206 5:46227938-46227960 TGGGAGCCCTTTGAGGTCAATGG + Intergenic
989869543 5:46570296-46570318 TTGGAGCGATTTGTGGAGTATGG + Intergenic
989869677 5:46572854-46572876 TTGGAGCGATTTGTGGAGTATGG + Intergenic
989869815 5:46575412-46575434 TTGGAGCGATTTGTGGAGTATGG + Intergenic
989869947 5:46577970-46577992 TTGGAGCGATTTGTGGAGTATGG + Intergenic
989870086 5:46580529-46580551 TTGGAGCGATTTGTGGAGTATGG + Intergenic
989870219 5:46583088-46583110 TTGGAGTGATTTGTGGAGTATGG + Intergenic
989870353 5:46585646-46585668 TTGGAGCGATTTGTGGAGTATGG + Intergenic
989870494 5:46588203-46588225 TTGGAGCGATTTGTGGAGTATGG + Intergenic
989870908 5:46595883-46595905 TTGGAGCGATTTGTGGAGTATGG + Intergenic
989871036 5:46598272-46598294 TTGGAGCGATTTGTGGAGTATGG + Intergenic
989871173 5:46600832-46600854 ATGGAGCGATTTGTGGAGTATGG + Intergenic
989871311 5:46603389-46603411 TTGGAGCGATTTGTGGAGTATGG + Intergenic
989871450 5:46605947-46605969 TTGGAGCGATTTGTGGAGTATGG + Intergenic
989871591 5:46608506-46608528 TTGGAGCGATTTGTGGAGTATGG + Intergenic
989871727 5:46611064-46611086 TTGGAGCGATTTGTGGAGTGTGG + Intergenic
989871851 5:46613284-46613306 TTGGAGCGATTTGTGGAGTATGG + Intergenic
989871991 5:46615842-46615864 TTGGAGCGATTTGTGGAGTATGG + Intergenic
989872131 5:46618401-46618423 TTGGAGCGATTTGTGGAGTATGG + Intergenic
989872270 5:46620958-46620980 TTGGAGCGATTTGTGGAGTATGG + Intergenic
989872400 5:46623519-46623541 TTGGAGTGATTTGTGGAGTATGG + Intergenic
989872551 5:46626245-46626267 TTGGAGCGATTTGTGGAGTATGG + Intergenic
989872766 5:46629995-46630017 TTGGAGCGATTTGTGGAGTATGG + Intergenic
989872901 5:46632553-46632575 TTGGAGCAATTTGTGGAGTATGG + Intergenic
989873026 5:46634944-46634966 TTGGAGCGATTTGTGGAGTATGG + Intergenic
989873169 5:46637502-46637524 TTGGAGCGATTTGTGGAATATGG + Intergenic
989873309 5:46640062-46640084 TTGGAGCGATTTGTGGAGTATGG + Intergenic
989873441 5:46642620-46642642 TTGGAGCGATTTGTGGAGTATGG + Intergenic
989873578 5:46645180-46645202 TTGGAGCGATTTGTGGAGTATGG + Intergenic
989873719 5:46647739-46647761 TTGGAGCAATTTGTGGAGTATGG + Intergenic
989873852 5:46650127-46650149 TTGGAGCGATTTGTGGAGTATGG + Intergenic
989873994 5:46652685-46652707 TTGGAGCGATTTGTGGAGTATGG + Intergenic
989874127 5:46655243-46655265 TTGGAGCGATTTGTGGAGTATGG + Intergenic
989874262 5:46657801-46657823 TTGGAGCGATTTGTGGAGTATGG + Intergenic
989874405 5:46660359-46660381 TTGGAACGATTTGTGGAGTATGG + Intergenic
989874540 5:46662917-46662939 TTGGAGCGATTTGTGGAGTATGG + Intergenic
989874673 5:46665473-46665495 TTGGAGCGATTTGTGGAGTATGG + Intergenic
989874804 5:46668033-46668055 TTGGAGCGATTTGTGGAGTATGG + Intergenic
989874938 5:46670591-46670613 TTGGAGCGATTTGTGGAGTATGG + Intergenic
989875083 5:46673149-46673171 TTGGAGCGATTTGTGGAGTATGG + Intergenic
989875218 5:46675706-46675728 TTGGAGCGATTTGTGGAGTATGG + Intergenic
989875355 5:46678267-46678289 TTGGAGCGATTTGTGGAGTATGG + Intergenic
989875494 5:46680825-46680847 TTGGAGCGATTTGTGGAGTATGG + Intergenic
989875769 5:46685944-46685966 TTGGAGCGATTTGTGGAGTATGG + Intergenic
989875911 5:46688502-46688524 TTGGAGCGATTTGTGGAGTATGG + Intergenic
989876043 5:46691065-46691087 TTGGAGTGATTTGTGGAGTATGG + Intergenic
989876106 5:46692431-46692453 TTGGAGCGATTTCTGGAGTATGG + Intergenic
989876244 5:46694991-46695013 TTGGAGCGATTTGTGGAGTATGG + Intergenic
989876381 5:46697550-46697572 TTGGAGCGATTTGTGGAGTATGG + Intergenic
989876515 5:46700107-46700129 TTGGAGCGATTTGTGGAGTATGG + Intergenic
989876650 5:46702666-46702688 TTGGAGCGATTTGTGGAGTATGG + Intergenic
989876786 5:46705225-46705247 TTGCAGCGATTTGTGGAGTATGG + Intergenic
989876918 5:46707782-46707804 TTGGAGCGATTTGTGGAGTATGG + Intergenic
989877049 5:46710345-46710367 TTGGAGCGATTTGTGGAGTATGG + Intergenic
989877189 5:46712903-46712925 TTGGAGCGATTTGTGGAGTATGG + Intergenic
989877325 5:46715461-46715483 TTGGAGCGATTTGTGGAGTATGG + Intergenic
989877461 5:46718018-46718040 TTGGAGCGATTTGTGGAGTATGG + Intergenic
989877605 5:46720575-46720597 TTGGAGCGATTTGTGGAGTATGG + Intergenic
989877740 5:46723136-46723158 TTGGAGCGATTTGTGGAATATGG + Intergenic
989877877 5:46725697-46725719 TTGGAGCGATTTGTGGAGTATGG + Intergenic
989878019 5:46728255-46728277 TTGGAGCGATTTGTGGAGTATGG + Intergenic
989878153 5:46730813-46730835 TTGGAGCGATTTGTGGAGTATGG + Intergenic
989878359 5:46734737-46734759 TTGGAGCGATTTGTGGAGTATGG + Intergenic
989878493 5:46737296-46737318 TTGGAGCGATTTGTGGAGTATGG + Intergenic
989878629 5:46739856-46739878 TTGGAGCGATTTGTGGAGTATGG + Intergenic
989878756 5:46742242-46742264 TTGGAGCGATTTGTGGAGTATGG + Intergenic
989878894 5:46744803-46744825 TTGGAGCGATTTGTGGAGTATGG + Intergenic
989879038 5:46747361-46747383 TTGGAGCGATTTGTGGAGTATGG + Intergenic
989879180 5:46749918-46749940 TTGGAGCGATTTGTGGAGTATGG + Intergenic
989879317 5:46752479-46752501 TTGGAGCGATTTGTGGAGTATGG + Intergenic
989879451 5:46755043-46755065 TTGGAGCGATTTGTGGAGTATGG + Intergenic
989879589 5:46757601-46757623 TTGGAGCGATTTGTGGAGTATGG + Intergenic
989879730 5:46760160-46760182 TTGGAGCGATTTGTGGAGTATGG + Intergenic
989879861 5:46762551-46762573 TTGGAGCGATTTGTGGAGTATGG + Intergenic
989879999 5:46765109-46765131 TTGGAGCGATTTGTGGAGTATGG + Intergenic
989880136 5:46767669-46767691 TTGGAGCGATTTGTGGAGTATGG + Intergenic
989880269 5:46770228-46770250 TTGGAGCGATTTGTGGAGTATGG + Intergenic
989880407 5:46772784-46772806 TTGGAGCGATTTGTGGAGTATGG + Intergenic
989880546 5:46775342-46775364 TTGGAGCGATTTGTGGAGTATGG + Intergenic
989880684 5:46777899-46777921 TTGGAGCGATTTGTGGAGTATGG + Intergenic
989880819 5:46780458-46780480 TTGGAGCGATTTGTGGAGTATGG + Intergenic
989880956 5:46783017-46783039 TTGGAGCGATTTGTGGAGTATGG + Intergenic
989881091 5:46785581-46785603 TTGGAGCGATTTGTGGAGTATGG + Intergenic
989881229 5:46788140-46788162 TTGGAGCGATTTGTGGAGTATGG + Intergenic
989881366 5:46790698-46790720 TTGGAGCGATTTGTGGAGTGTGG + Intergenic
989881505 5:46793255-46793277 TTGGAGCGATTTGTGGAGTATGG + Intergenic
989881648 5:46795813-46795835 TTGGAGCGATTTGTGGAGTATGG + Intergenic
990014459 5:51042323-51042345 TGAGAGCCACTTGAGGAGTATGG + Intergenic
990273490 5:54171214-54171236 TTGGAGTCATTTGTGGGGAGGGG - Intronic
990764696 5:59169262-59169284 GGGAAGCACTTTGTGGAGAAAGG + Intronic
993877767 5:93328015-93328037 TGGCAGGCAGGTGTGGAGAATGG - Intergenic
995570518 5:113475589-113475611 TGGAAGCCATATGGAGAGAAAGG - Intronic
998573375 5:143286213-143286235 TTGGAGCCTTTTTTGTAGAAAGG - Intronic
998727905 5:145039685-145039707 TGGGAGCCATTTGTGTATAATGG - Intergenic
1002100516 5:176855395-176855417 TGGGAACCATTGGTGGGGATGGG + Intronic
1002660124 5:180786096-180786118 TGGGAGCCATGTGTTGAAGACGG + Intergenic
1002717257 5:181235236-181235258 TGGAAGCCATTTGGGGAGGCAGG + Exonic
1002975481 6:2070994-2071016 TGGGTGTCATTTCTGGAGCAAGG - Intronic
1003258025 6:4490785-4490807 TGGGGGTCAGTTGTGAAGAAAGG + Intergenic
1005593075 6:27348673-27348695 TGGGAGGCATATGTGGACACTGG - Intergenic
1005836129 6:29710902-29710924 TGGGAACCATTACTAGAGAAGGG - Intergenic
1005856901 6:29869658-29869680 TGGGAACCATTACTAGAGAAGGG - Intergenic
1005862719 6:29913792-29913814 TGGGAACCATTACTAGAGAAGGG - Intergenic
1007091128 6:39185565-39185587 TGGGAGCCCAGTGTGGAGAGGGG - Intergenic
1007694233 6:43721907-43721929 TGTGAGCCATCTGTGTAGAGAGG + Intergenic
1008896133 6:56557889-56557911 TGGGAGCAATTTGCCTAGAACGG - Intronic
1009250905 6:61297164-61297186 TGGGAGTTATTTGTGGCCAATGG - Intergenic
1009259098 6:61460780-61460802 TGGGAGCCATTTGAGGCCTACGG + Intergenic
1009937340 6:70249436-70249458 TGGGAGACACTGGTAGAGAAAGG + Intronic
1011639829 6:89408485-89408507 TGTTAGCCTTTTGTGGGGAAGGG - Intronic
1012067623 6:94568690-94568712 TAGGAGCCATATGTGGAGAACGG + Intergenic
1012867410 6:104634679-104634701 AGAGAGCCATTTGTGGGGAGGGG + Intergenic
1014861871 6:126478920-126478942 TAGGATTCATTTGTGAAGAAAGG + Intergenic
1018522000 6:164659683-164659705 TGGTAACCTTTTGTTGAGAAGGG + Intergenic
1020082706 7:5295437-5295459 GGGGTGCCATTTGCTGAGAAGGG - Intronic
1020340985 7:7110759-7110781 GGGGAGCCATTTCCAGAGAAGGG - Intergenic
1020862178 7:13507670-13507692 AGGGAGCCAGTTGAGGGGAAAGG - Intergenic
1021900202 7:25277718-25277740 CGGGATCCATTTGTGAAGGAAGG + Intergenic
1023868164 7:44248698-44248720 TGGGAGCTATTTGAGGAAGAAGG - Intronic
1025015953 7:55439290-55439312 TGGAAGCCGTGTGTGGAGAAGGG + Intronic
1025315938 7:58028979-58029001 TTGGAGCGATTTGTGGCCAATGG + Intergenic
1025518554 7:61688000-61688022 TGTGAGCCGTTTGTGGAATATGG - Intergenic
1025521962 7:61746165-61746187 TTGGAGCAATTTGTGGACTATGG - Intergenic
1025530810 7:61880600-61880622 TGGGAGCCCTTTGAGGCCAAAGG - Intergenic
1025536640 7:61956503-61956525 TGGGAGCCATTTGAGGCCTATGG + Intergenic
1025542880 7:62116647-62116669 TGTGAGCCGTTTGTGGAATATGG - Intergenic
1025545695 7:62164455-62164477 TTGGAGCAATTTGTGGACTATGG - Intergenic
1025549991 7:62233718-62233740 TGGGAGCTCTTTGTGGCCAATGG + Intergenic
1025570977 7:62566278-62566300 TTGGAGCCTTTTGTGGCCAATGG - Intergenic
1025582042 7:62731847-62731869 TGGGAGCTATTTGAGGTCAATGG + Intergenic
1025582196 7:62734065-62734087 TGGGAGCCCTTTGAGGCCAATGG + Intergenic
1025583788 7:62755070-62755092 TGGGAGCTATTTGAGGCCAATGG + Intergenic
1025586947 7:62801935-62801957 TGGGAGCCATTTGTGGCCAATGG + Intergenic
1025589489 7:62838706-62838728 TGGGAGCTCTTTGTGGCCAATGG + Intergenic
1025591737 7:62868985-62869007 TGGGAGCAAATTGTGGACTATGG + Intergenic
1025597111 7:62943842-62943864 TGGGAGCTCATTGAGGAGAATGG + Intergenic
1025597852 7:62953531-62953553 TGGGAGCTATTTGAGGCCAATGG + Intergenic
1025599375 7:62976203-62976225 TGGGAGCCCATTGAGGACAATGG + Intergenic
1025871083 7:65434876-65434898 TCGGAGCCACTAGTGTAGAAAGG - Intergenic
1027625658 7:80541966-80541988 TGGGAGGCTTTTGTGTATAAAGG + Intronic
1029169262 7:98618998-98619020 TTGGAACACTTTGTGGAGAAAGG + Intronic
1034245222 7:149638859-149638881 TGGGAGACATTTGTCCAGAAAGG + Intergenic
1036198518 8:6745414-6745436 TGGGATTCATTTCTGGAGAGTGG - Intronic
1037810505 8:22083789-22083811 TGGGAGCTCTTTTTGGACAACGG - Intergenic
1038643927 8:29348406-29348428 TTGGAGCGCTTTGGGGAGAAGGG + Intronic
1040115340 8:43611471-43611493 TGGGAGCCCTTTGAGGCCAATGG + Intergenic
1040115432 8:43612673-43612695 TGGGAGCCCTTTGAGGCCAATGG + Intergenic
1040117176 8:43635642-43635664 TGGGAGCCCTTTGTGGCATATGG + Intergenic
1040128928 8:43771711-43771733 TGGGAGCCCTTTGAGGCCAATGG + Intergenic
1040130880 8:43795069-43795091 TGGGAGCCATTTGGGGCCTATGG + Intergenic
1040131952 8:43807443-43807465 TGGGAGACCTTTGAGGACAATGG + Intergenic
1040133130 8:43820994-43821016 TGGGAGCCATTTGTGTCCAGTGG + Intergenic
1040352443 8:46582612-46582634 TGGCATCCATGTGTGAAGAAGGG - Intergenic
1041181798 8:55256959-55256981 TAGGTGCCATTTATGAAGAATGG - Intronic
1042111527 8:65386605-65386627 TTGGAGAAATTTGTGGAAAATGG - Intergenic
1044239022 8:89867206-89867228 TGGGAGCGATTTGTTTATAAGGG - Intergenic
1044334951 8:90970737-90970759 TGGAAGCCATGTGTTGAGGATGG + Intronic
1045206918 8:100052852-100052874 GGGTTGCCATTTGTGGAAAAGGG + Exonic
1045567856 8:103339672-103339694 TGGGAGTCAAATCTGGAGAAGGG - Intergenic
1046535562 8:115504318-115504340 TTGCAACCATTTGTGGACAATGG - Intronic
1046675910 8:117108420-117108442 TTGGAGCCATTTCTGGAAAGAGG - Intronic
1047058817 8:121198640-121198662 TGGAAGCCATTTGTTGAAAATGG + Intergenic
1047180117 8:122579381-122579403 TGGAAGCCATGTGTTGAAAATGG + Intergenic
1047987044 8:130246136-130246158 AGGAAGCCATTTGCGGTGAAGGG + Intronic
1048753526 8:137706348-137706370 TGGTAGAGATTTGGGGAGAAAGG + Intergenic
1050464810 9:5910851-5910873 TGGGAGCCATGTGTTAAGGATGG + Intronic
1051407539 9:16755006-16755028 TGTGGGCAATATGTGGAGAATGG - Intronic
1051615758 9:19004704-19004726 TGGGGGCCTGTTGTGGAGTAGGG + Intronic
1052285935 9:26785877-26785899 TGGGAGCCATGGCTGGAGCAGGG - Intergenic
1053602877 9:39628617-39628639 AAAGAGCCATTTGTGCAGAAGGG + Intergenic
1053860525 9:42382363-42382385 AAAGAGCCATTTGTGCAGAAGGG + Intergenic
1054250660 9:62713819-62713841 AAAGAGCCATTTGTGCAGAAGGG - Intergenic
1054362508 9:64189672-64189694 TGGGAGCCATTTGAGGCCTACGG + Intergenic
1054564768 9:66748331-66748353 AAAGAGCCATTTGTGCAGAAGGG - Intergenic
1055565463 9:77564175-77564197 TGAGAACCACATGTGGAGAAAGG - Intronic
1055574025 9:77645187-77645209 TGGAATCCTTTTGTGGAGTATGG - Intronic
1058983842 9:110194274-110194296 TGGAAGTCATCTTTGGAGAAAGG - Intronic
1059030327 9:110686522-110686544 TGCAAACCATTTGTTGAGAAGGG - Intronic
1059642004 9:116226642-116226664 TATGAGGCAGTTGTGGAGAAGGG - Intronic
1059931058 9:119261600-119261622 TGGTAGTCATGTGTGGAGACAGG - Intronic
1060031443 9:120218129-120218151 TGGGAACCTTTTGAGGAGGAGGG - Intergenic
1060211538 9:121713424-121713446 TTGGAGCCATTTGTAGACAGGGG + Intronic
1203785643 EBV:126080-126102 AGGGAGCCAGTTGGGGAGGAGGG - Intergenic
1203379625 Un_KI270435v1:20426-20448 TTGGAGCCCTTTGTGGCCAATGG + Intergenic
1203379955 Un_KI270435v1:26617-26639 TTGGAGCCATTTGTGGCCAATGG + Intergenic
1203374898 Un_KI270442v1:361494-361516 TTGGAGCTATTTGTGGCCAATGG + Intergenic
1203398978 Un_KI270519v1:62374-62396 TGGGAGCCCTTTGTGGCCTATGG + Intergenic
1203399444 Un_KI270519v1:72658-72680 TTGGAGCCCTTTGTGGCCAATGG + Intergenic
1203400161 Un_KI270519v1:81224-81246 TTGGAGCCATTTGTGGCCTATGG + Intergenic
1203402513 Un_KI270519v1:124808-124830 TGGGAGCCATTTAAGGACTATGG - Intergenic
1203411340 Un_KI270579v1:9152-9174 TTGGAGCACTTTGTGGTGAATGG - Intergenic
1203415037 Un_KI270584v1:1230-1252 TTGGAGCCATTTGTGGCATATGG - Intergenic
1203414954 Un_KI270590v1:4404-4426 TTGGAGCCCTTTGTGGCCAATGG - Intergenic
1203685970 Un_KI270757v1:60013-60035 TTGGAGCCGTTTGTGGCCAATGG - Intergenic
1203686622 Un_KI270757v1:71137-71159 TTGGAGCCCTTTGTGGCCAATGG - Intergenic
1185465738 X:353517-353539 CTGGAGCCATTTGTTTAGAATGG - Intronic
1187526734 X:20061288-20061310 TGGGTGACATTTAGGGAGAAGGG - Intronic
1187565568 X:20446283-20446305 TGGGAGCAATCTGTAGAGAAAGG - Intergenic
1191120830 X:56902704-56902726 TTGGGGCCTGTTGTGGAGAAAGG + Intergenic
1191263277 X:58353150-58353172 TGGGAACTCTTTGTGGACAATGG + Intergenic
1191265675 X:58389940-58389962 TGGGAGCTCTTTGTGGCCAATGG + Intergenic
1191272320 X:58491010-58491032 TGGGAGCCCTTTGAGGACTATGG + Intergenic
1191272454 X:58493065-58493087 TGGGAGCCCTTTGAGGCCAATGG + Intergenic
1191581525 X:62767319-62767341 TGGGAGCCCTTTGAGGCCAATGG - Intergenic
1191912187 X:66162981-66163003 GGGGAGCAATTTGTGGCGACAGG - Intronic
1192156124 X:68747989-68748011 TGAGAGCCATTTATGGCAAAGGG + Intergenic
1193132019 X:77930390-77930412 TGGGAGCAAGGTGTGGGGAAGGG - Intronic
1198134231 X:133731492-133731514 TGGCTGCCTTTTGTGAAGAAAGG - Intronic
1199080992 X:143576721-143576743 TGGGAGCCATGTGTGGAACGTGG + Intergenic
1199178677 X:144825366-144825388 TGTGTGCCATTTGTGGCCAATGG + Intergenic
1199879939 X:151965930-151965952 TGGAAGACATTTGTGGAGGCAGG - Intronic
1201093790 Y:10525940-10525962 TTGGAGCCTTTTGTGGCCAATGG + Intergenic
1201096334 Y:10621641-10621663 TTGGAGCCTTTTGTGGCCAATGG - Intergenic
1201777139 Y:17678398-17678420 TGGGAGCCAATTGTGGACTAAGG - Intergenic
1201824418 Y:18227594-18227616 TGGGAGCCAATTGTGGACTAAGG + Intergenic