ID: 919644833

View in Genome Browser
Species Human (GRCh38)
Location 1:200085058-200085080
Sequence GGGTGGGTTACTGCCAGTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 151}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919644822_919644833 4 Left 919644822 1:200085031-200085053 CCGGGGCTCTACCCTCAGGAGGC 0: 1
1: 0
2: 4
3: 37
4: 373
Right 919644833 1:200085058-200085080 GGGTGGGTTACTGCCAGTGGGGG 0: 1
1: 0
2: 0
3: 14
4: 151
919644826_919644833 -7 Left 919644826 1:200085042-200085064 CCCTCAGGAGGCTCCAGGGTGGG 0: 1
1: 1
2: 8
3: 58
4: 586
Right 919644833 1:200085058-200085080 GGGTGGGTTACTGCCAGTGGGGG 0: 1
1: 0
2: 0
3: 14
4: 151
919644828_919644833 -8 Left 919644828 1:200085043-200085065 CCTCAGGAGGCTCCAGGGTGGGT 0: 1
1: 0
2: 1
3: 40
4: 401
Right 919644833 1:200085058-200085080 GGGTGGGTTACTGCCAGTGGGGG 0: 1
1: 0
2: 0
3: 14
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919644833 Original CRISPR GGGTGGGTTACTGCCAGTGG GGG Intronic
901308496 1:8250760-8250782 GGGAGGGGCACGGCCAGTGGAGG + Intergenic
902153404 1:14463105-14463127 GGGTGGGTTAATGCAAATTGAGG + Intergenic
902260117 1:15218834-15218856 GGGTGGGTTAATGCAAATTGAGG - Intronic
902814280 1:18907392-18907414 GGGTGGGCTGCTGGCAGTGCAGG - Exonic
904584936 1:31575327-31575349 GGGTGTGTTAGTGCCAGTGCTGG + Intergenic
905389188 1:37625382-37625404 GGATGGGTTAGGGACAGTGGTGG + Intronic
905764939 1:40592499-40592521 GGGTGGGTTAATGCAAATTGAGG - Intergenic
905889945 1:41512795-41512817 GGGTGAGTTCCTGCCCCTGGTGG - Exonic
905937241 1:41834280-41834302 GAGTGGTTTACTCACAGTGGGGG - Intronic
906851138 1:49251420-49251442 GGGTGGGGCACTGGCAGGGGTGG - Intronic
907240806 1:53080048-53080070 GGGTGGGGTGCTGCCAGTTTAGG + Intronic
911461314 1:98194560-98194582 GGGTGGGGTGCTGACAGTGGTGG + Intergenic
918324290 1:183394964-183394986 GGGTGGGTAACTGCCATCCGGGG - Intronic
919644833 1:200085058-200085080 GGGTGGGTTACTGCCAGTGGGGG + Intronic
919880169 1:201895856-201895878 AGATGGGTGACTGCCAGTGTTGG + Intergenic
920667306 1:207972451-207972473 GGGCCGATTTCTGCCAGTGGAGG + Intergenic
924771988 1:247087339-247087361 GGGTGGGTTCCTGCCTGCAGGGG + Intergenic
1064710903 10:18123421-18123443 GAGTGGGTTAATGCAAATGGAGG - Intergenic
1071526412 10:86362290-86362312 GGGTGGGCTCCAGCCAGGGGAGG - Intronic
1071611768 10:87038451-87038473 GGGTGGGGCACTGGCAGGGGAGG + Intergenic
1072441127 10:95456390-95456412 GGGTTAGTTACTGCCAGAGTGGG + Intronic
1073461864 10:103670440-103670462 ATGGGAGTTACTGCCAGTGGCGG - Intronic
1076189428 10:128472559-128472581 GGGTGGGTTTCTGCCACCGTGGG - Intergenic
1078245785 11:9572999-9573021 GGGTGGGTGACTGTTAGGGGCGG - Intergenic
1079182418 11:18205050-18205072 GTGTGGGTGAGTGCCAGTGGTGG - Intronic
1080853707 11:36093578-36093600 GGGAGCGTCACTGCCTGTGGAGG - Intronic
1084712878 11:70854960-70854982 GGGTGGGTTTCTGATAGTCGTGG - Intronic
1089456309 11:118627879-118627901 GGGTGGGCAGCTGCCTGTGGTGG + Exonic
1089918668 11:122185519-122185541 GGGTGGGGCACTGGCAGAGGAGG - Intergenic
1090630785 11:128645537-128645559 GGATGGAGTACTGACAGTGGAGG - Intergenic
1091294929 11:134466960-134466982 TGGTGGGTTAGGGCCAGAGGAGG + Intergenic
1091757212 12:3061846-3061868 GGGTGGCTTAGTGACAGTAGAGG - Intergenic
1092934482 12:13347833-13347855 GGCTGGGGTACAGTCAGTGGTGG - Intergenic
1096779136 12:53982194-53982216 CGGTGGGTGCCTGGCAGTGGCGG + Intergenic
1100046192 12:90383533-90383555 GGTGGGGTTCCTGGCAGTGGTGG - Intergenic
1105210608 13:18254701-18254723 GGGTGGGAAACTGCCAGAGGTGG - Intergenic
1105796262 13:23856509-23856531 GGGTGGGTTAATGCAAATTGGGG + Intronic
1107169012 13:37317425-37317447 GGGTGGGTGCCTGTCAGTGGGGG + Intergenic
1110070367 13:71168498-71168520 GGCTCGGTCATTGCCAGTGGTGG - Intergenic
1114387255 14:22268083-22268105 AAGTGGGTTACTGAAAGTGGTGG - Intergenic
1116641752 14:47472566-47472588 GGTTTAGTTAATGCCAGTGGAGG + Intronic
1117651353 14:57909216-57909238 GGGTGGGGTGCTGATAGTGGGGG - Intronic
1118710142 14:68512174-68512196 GTGGGGGTCACTGCAAGTGGGGG - Intronic
1119666598 14:76489397-76489419 GGGTGTGTGGCTGCCTGTGGTGG - Intronic
1121040339 14:90741102-90741124 GGGTGAGTGACTGCCAGTGTTGG - Intronic
1122029043 14:98899361-98899383 GGCTGGGGTCCTGCCTGTGGTGG + Intergenic
1122302250 14:100737839-100737861 GGGGGGGGTAGTGCGAGTGGTGG - Exonic
1127293798 15:57592251-57592273 GGGAGGGTCACTGCCAGAGCCGG - Intronic
1128067535 15:64774524-64774546 GGGTGGGATCCTGCCAGGAGGGG - Intronic
1129387972 15:75206421-75206443 GGTTTGGGTGCTGCCAGTGGTGG - Exonic
1136267968 16:29131966-29131988 AGGTGGGTCCCTGCCCGTGGGGG + Intergenic
1140044435 16:71431386-71431408 AGGTGGCATTCTGCCAGTGGTGG + Intergenic
1142008853 16:87703651-87703673 GGGTGGGCTGCAGCCAGTGGGGG + Intronic
1142071275 16:88092304-88092326 AGGTGGGTCCCTGCCCGTGGGGG + Intronic
1142158017 16:88541555-88541577 GGGTGGGTTAATGCAAATTGAGG + Intergenic
1142229579 16:88893550-88893572 GGGTGGGTTCCTGCCCCTGGCGG + Intronic
1142430463 16:90023449-90023471 GGGTGGGTTTCAGCTGGTGGGGG + Intronic
1144853895 17:18257823-18257845 GGGTGGGTGACTGGCAGGGTCGG - Intronic
1145223113 17:21105300-21105322 GGGGGCGTCACTGCCTGTGGAGG + Intergenic
1145828775 17:27898070-27898092 GGGTGGGGCACTGACAGTTGTGG + Intergenic
1146184717 17:30717357-30717379 GGGAGGGTTGCTGGGAGTGGAGG - Intergenic
1148107724 17:45128246-45128268 GGGTGGGACACAGCAAGTGGGGG + Intronic
1151950403 17:77350318-77350340 GGGTGAGTTTCTGCCTTTGGGGG - Intronic
1160466012 18:79077281-79077303 GTGGGGGTTACTGCCAGAAGGGG + Intronic
1161389974 19:4015755-4015777 CGGTGGGTCACAGCCAGAGGAGG - Intronic
1162974066 19:14198336-14198358 GGGAGGGTTGCTGGGAGTGGAGG + Intronic
1163258713 19:16173582-16173604 GGGTGGGTGACAGCCAGGGCAGG - Intergenic
1164559056 19:29276094-29276116 GGGTGGCTGAGAGCCAGTGGGGG - Intergenic
1165494208 19:36142260-36142282 GGAGGGGTTAGTGCCAGGGGCGG - Intronic
1166756746 19:45197066-45197088 GGGTGGGATGCTGGGAGTGGAGG + Intronic
925138371 2:1534834-1534856 GGGGGGGTTACACACAGTGGGGG - Intronic
925316779 2:2932670-2932692 GGGTTGGTTTCTGCCAATGGGGG - Intergenic
926420181 2:12688217-12688239 GGGTGTGTTACAGGCAGTGATGG - Intergenic
926749554 2:16187746-16187768 GGGGCGGTGACTGCCAGTGTTGG - Intergenic
927429627 2:23016340-23016362 GTCTGGGTTACTGCAAGAGGAGG - Intergenic
927599711 2:24430326-24430348 GGGTTTGTTACTGCCAGAGTTGG + Intergenic
933814275 2:86053042-86053064 GGGTGGGTGACTCCCACAGGAGG - Intronic
933864564 2:86504308-86504330 GTGTGGGATACTGATAGTGGTGG + Exonic
935152423 2:100449868-100449890 GGTTGGATTCCTGCCTGTGGAGG - Intergenic
940845551 2:158637946-158637968 GGGTGGGCTCCTGCCAGAGCTGG - Intronic
943247422 2:185473351-185473373 GGGTGGGAGACTGCCAGTTTGGG + Intergenic
946195113 2:218028224-218028246 GGGTGGAGTAAGGCCAGTGGGGG - Intergenic
1168957404 20:1844013-1844035 GAGTGGGTTACTGACAGAGTGGG + Intergenic
1176169507 20:63690596-63690618 GGGAGGGTTGCAGCCCGTGGGGG - Intronic
1177269619 21:18830324-18830346 GGGTGGTTTTATTCCAGTGGTGG + Intergenic
1179457044 21:41507356-41507378 GGGCGGGTTCCTGCCGGTGCCGG + Intronic
1179957570 21:44749971-44749993 GGGTGGGTGACTGGCACTGTGGG - Intergenic
1180174859 21:46082556-46082578 GGGTGGGTCCCTGCCAGGAGGGG - Intergenic
1180574492 22:16759993-16760015 GGCCGGGTTACAGTCAGTGGAGG - Intergenic
1181693982 22:24583843-24583865 GGCTGGCTTAGGGCCAGTGGTGG + Intronic
1182491507 22:30675292-30675314 GGGTGGGTTATGGGCAGAGGTGG - Intergenic
1182686241 22:32123102-32123124 TGGGGCGTCACTGCCAGTGGCGG + Intergenic
1182856105 22:33518805-33518827 GGGTGTGGTACTGACCGTGGGGG + Intronic
1183018128 22:35006645-35006667 GGGTGGGGTAATGTCAGTGCAGG - Intergenic
1183740136 22:39664602-39664624 GGGCGGGGTCCTGCAAGTGGCGG - Intronic
1185284276 22:49993406-49993428 GGGTGGGTTTCCGGCGGTGGTGG + Intergenic
949376921 3:3400853-3400875 GGGTGGGTGCTTGCCAGTGGGGG + Intergenic
950142402 3:10624431-10624453 GGGTGTGTCTCTGCCTGTGGTGG + Intronic
950226511 3:11239803-11239825 GGGTGGGGGGCTGCCACTGGGGG - Intronic
950450507 3:13062501-13062523 GGGTGGGGTCCTGGCAGGGGAGG + Intronic
950923066 3:16715152-16715174 GGGCAGGGTACTGGCAGTGGTGG + Intergenic
952977554 3:38709067-38709089 GGTTGGGATTCTGCCAGTGCTGG + Intronic
957737700 3:84224483-84224505 GGGTGTGTCACTGGCCGTGGAGG - Intergenic
960101140 3:113745387-113745409 GGTTGGGTCACAGCGAGTGGAGG - Intronic
960579175 3:119259635-119259657 GGGTGGCTGCCTGCAAGTGGAGG + Intergenic
962349493 3:134646306-134646328 GGGTGGCTCCCTGGCAGTGGTGG + Intronic
962740770 3:138361388-138361410 GGGTGGGACAATGCTAGTGGTGG + Intronic
964433569 3:156629701-156629723 GGGTAGGTTACTGCTAGTATTGG - Intergenic
966964994 3:184982127-184982149 GGGTGGGGGACAGCTAGTGGGGG + Intronic
969517926 4:7658825-7658847 GGATGGGAAACTGTCAGTGGTGG + Intronic
970403288 4:15738178-15738200 GGTGGGGATGCTGCCAGTGGGGG + Intronic
970654235 4:18213485-18213507 GGGTGGGTGCATGTCAGTGGGGG + Intergenic
975221516 4:71817939-71817961 GGTTGGGCAACTGCAAGTGGGGG + Intergenic
975924411 4:79431972-79431994 GGGAGGGTCACTGCCAGCTGAGG - Intergenic
979441120 4:120750357-120750379 CAGCGGGCTACTGCCAGTGGCGG + Intronic
981748477 4:148072401-148072423 GGTGGCGTGACTGCCAGTGGAGG - Exonic
987788131 5:22528277-22528299 GGGGGGGTTGCTTCCACTGGTGG + Intronic
992410976 5:76504962-76504984 GGGTGGATTTCAGCAAGTGGGGG - Intronic
993429467 5:87814127-87814149 AGGTGGGTGCATGCCAGTGGGGG - Intergenic
994726324 5:103440576-103440598 GGGTGGGTGAGTGTCAGTAGTGG + Intergenic
997472675 5:134125419-134125441 GGGTGGGGCCCTGCCAGTCGGGG - Intronic
999142444 5:149371438-149371460 AGGTGGGTGATTGGCAGTGGGGG + Intronic
1001113953 5:168923370-168923392 GGGGAGGATGCTGCCAGTGGAGG - Intronic
1005229112 6:23679896-23679918 GGGTGGGTATCAGCTAGTGGTGG - Intergenic
1007423357 6:41733012-41733034 GGCTGGGCTACTCCCTGTGGGGG + Intronic
1010675913 6:78742752-78742774 GGGTGGGTTAATGCAAATTGAGG - Intergenic
1014454339 6:121620087-121620109 GGGTAGGTTAAAGCCAGTGATGG + Intergenic
1014616023 6:123600504-123600526 GGGTGGAGTCCTGGCAGTGGGGG + Intronic
1024717215 7:52093073-52093095 GGGTGGGATTCTTGCAGTGGTGG - Intergenic
1024747671 7:52427161-52427183 GGGTGGGTTAATGCAAATTGAGG - Intergenic
1025258193 7:57399424-57399446 GGGTGGGCACCTGACAGTGGGGG + Intergenic
1026311416 7:69188057-69188079 GGGTGGGTCAATGCCAGGGAGGG + Intergenic
1026974837 7:74490928-74490950 AGGTGGGGTACAGCCAGTGAAGG + Intronic
1030641469 7:112011104-112011126 GGGTGGCTTACATCCAGTGAAGG + Intronic
1033839137 7:145352779-145352801 GGCTGGTTAACTGACAGTGGTGG + Intergenic
1035074367 7:156168773-156168795 GGGTGGGACACTCCCAGCGGGGG + Intergenic
1035226132 7:157433445-157433467 GGGTGGGTGACTGCAGGTGCGGG - Intergenic
1037209644 8:16370938-16370960 GGGTGGGTTCCAGTCAGAGGTGG + Intronic
1037764817 8:21766138-21766160 GGGTGGGGTCCTGCACGTGGAGG - Intronic
1042827628 8:72994390-72994412 GTGTGGGTCACTGCCAATGTAGG - Intergenic
1044565145 8:93654579-93654601 GGGTGGGAGCCTGCAAGTGGTGG + Intergenic
1048456540 8:134583598-134583620 GGGTGTGTCGGTGCCAGTGGTGG - Intronic
1049494426 8:142923079-142923101 GGAGGGGTGACTGCCAGTGAGGG - Intergenic
1049879674 8:145053115-145053137 GGGTGGGTTTCTGCCTCTTGAGG - Exonic
1052383640 9:27799373-27799395 GGTTGGCTTACTCCCAGTGCTGG + Intergenic
1052987957 9:34501833-34501855 GGGTGGGTAACTGGCAGGGGCGG - Intronic
1053181593 9:35976261-35976283 GGCAGGGTGACTGGCAGTGGTGG + Intergenic
1054965960 9:71026831-71026853 GTGTGTGTTGGTGCCAGTGGTGG - Intronic
1056590459 9:87962756-87962778 GGGTGGGTACCTGCCACTGGTGG + Intergenic
1056827973 9:89890108-89890130 GTGAGGGTTACTCCCAGTGCTGG - Intergenic
1058473575 9:105306560-105306582 GGGTGGGAAGCTGCCAGGGGTGG - Intronic
1059566354 9:115386025-115386047 GGGTAGGGGACTGCCAGAGGAGG + Intronic
1059657190 9:116367724-116367746 GTGTGGGGTTCAGCCAGTGGGGG - Exonic
1060206810 9:121687029-121687051 GGGTGGTTTCCTGCCAGTTGGGG + Intronic
1060396782 9:123321813-123321835 AGGAAGGTCACTGCCAGTGGAGG - Intergenic
1061329091 9:129881048-129881070 GGTTGGATTTCTGCCAGTGGGGG + Exonic
1062488359 9:136792067-136792089 GGGTGGGTTTCTGCTAGGGTTGG + Intronic
1203767921 EBV:36085-36107 TGCTGGGTTACTGCGGGTGGAGG - Intergenic
1188544846 X:31293745-31293767 ATGGGGGTTACTGCCAGTGCAGG + Intronic
1190989848 X:55535951-55535973 GGGTGGGTTCATGCTACTGGGGG + Intergenic
1191727179 X:64293572-64293594 GTGTGGGTCCCTGCCACTGGAGG - Intronic
1192693624 X:73391389-73391411 GGGTGGGGAACTGGCAGGGGTGG - Intergenic
1192800671 X:74462069-74462091 GGTGGGGTTTCTGCCACTGGAGG - Intronic
1195373931 X:104207065-104207087 GGGTGGGTTAATGCAAATTGAGG + Intergenic
1196175016 X:112630884-112630906 GGGAGGGTGATTCCCAGTGGTGG - Exonic
1199371742 X:147057641-147057663 GGGTAGGCTACTTCCACTGGAGG + Intergenic